Rroxscaffold_4G00309480

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
31262380 .. 31263053
674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00309480.1

Sequence Viewer

Length: 321 bp
ATGGGTCTCACTTGGGAAAGAAATGCAGTCAACAAAGTTGTAGCAGTACATGGACTAATCTTCATCTATTCAACTGGAAGCATACAGCAAGTACTCGTTACAGATATAGAGATGGTAAAAGAAATTAGTTTGTGTACATCTTTGAGCTTAGGGAAGCCTTCTTATCTATGTAAGGACCGGAGGCCACTATTAGGCCAAGGCATTCTAGCTTTAAATGGCTTAGTTTGGTCTCAGCAGAGGAAGATTATTGCTCCTCAATTCTATTTTGATAAGGTTAAGGTAGATAACTGCCTCTCTACTAGAATCATTAATTGTCTTTGA

Protein Analysis

106

Amino Acids

11.88

Weight (kDa)

9.24

Isoelectric Point (pI)

33.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 48, 93, 136
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 72
AluBI AGCT 2 cut(s) 147, 209
AluI AGCT 2 cut(s) 147, 209
Alw26I GTCTC 2 cut(s) 11, 234
AoxI GGCC 2 cut(s) 182, 193
AseI ATTAAT 1 cut(s) 309
AspS9I GGNCC 1 cut(s) 175
AvaII GGWCC 1 cut(s) 175
BccI CCATC 1 cut(s) 106
BcoDI GTCTC 2 cut(s) 11, 234
BfaI CTAG 2 cut(s) 206, 300
BmcAI AGTACT 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 175
Bpu10I CCTNAGC 1 cut(s) 148
BsaI GGTCTC 2 cut(s) 11, 234
BsaJI CCNNGG 1 cut(s) 196
BsaWI WCCGGW 1 cut(s) 177
Bsc4I CCNNNNNNNGG 1 cut(s) 191
Bse1I ACTGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 196
BseLI CCNNNNNNNGG 1 cut(s) 191
BseMII CTCAG 1 cut(s) 245
BseNI ACTGG 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 243
BshFI GGCC 2 cut(s) 184, 195
BsiSI CCGG 1 cut(s) 178
BslI CCNNNNNNNGG 1 cut(s) 191
BsmAI GTCTC 2 cut(s) 11, 234
BsmI GAATGC 1 cut(s) 201
BsnI GGCC 2 cut(s) 184, 195
Bso31I GGTCTC 2 cut(s) 11, 234
Bsp1407I TGTACA 1 cut(s) 134
BspANI GGCC 2 cut(s) 184, 195
BspCNI CTCAG 1 cut(s) 244
BspTNI GGTCTC 2 cut(s) 11, 234
BsrGI TGTACA 1 cut(s) 134
BsrI ACTGG 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 196
BstAUI TGTACA 1 cut(s) 134
BstDEI CTNAG 3 cut(s) 148, 220, 231
BstMAI GTCTC 2 cut(s) 11, 234
BsuRI GGCC 2 cut(s) 184, 195
Cfr13I GGNCC 1 cut(s) 175
Csp6I GTAC 3 cut(s) 47, 92, 135
CviAII CATG 1 cut(s) 50
CviJI RGCY 6 cut(s) 147, 157, 184, 195, 209, 219
CviKI_1 RGCY 6 cut(s) 147, 157, 184, 195, 209, 219
CviQI GTAC 3 cut(s) 47, 92, 135
DdeI CTNAG 3 cut(s) 148, 220, 231
DraI TTTAAA 1 cut(s) 213
Eco130I CCWWGG 1 cut(s) 196
Eco31I GGTCTC 2 cut(s) 11, 234
Eco47I GGWCC 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 1 cut(s) 53
FaiI YATR 4 cut(s) 51, 83, 107, 169
FatI CATG 1 cut(s) 49
FspBI CTAG 2 cut(s) 206, 300
HaeIII GGCC 2 cut(s) 184, 195
HapII CCGG 1 cut(s) 178
Hin1II CATG 1 cut(s) 53
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HinfI GANTC 1 cut(s) 303
HpaII CCGG 1 cut(s) 178
Hpy166II GTNNAC 2 cut(s) 31, 135
Hpy8I GTNNAC 2 cut(s) 31, 135
HpyAV CCTTC 1 cut(s) 168
HpyCH4V TGCA 1 cut(s) 26
HpyF3I CTNAG 3 cut(s) 148, 220, 231
Hsp92II CATG 1 cut(s) 53
LmnI GCTCC 1 cut(s) 256
LpnPI CCDG 2 cut(s) 60, 191
MaeI CTAG 2 cut(s) 206, 300
MaeIII GTNAC 1 cut(s) 97
MboII GAAGA 2 cut(s) 52, 253
MluCI AATT 3 cut(s) 123, 257, 310
MnlI CCTC 4 cut(s) 174, 231, 264, 302
MseI TTAA 3 cut(s) 212, 276, 309
MspI CCGG 1 cut(s) 178
Mva1269I GAATGC 1 cut(s) 201
NlaIII CATG 1 cut(s) 53
PctI GAATGC 1 cut(s) 201
PfeI GAWTC 1 cut(s) 303
PshBI ATTAAT 1 cut(s) 309
PspPI GGNCC 1 cut(s) 175
RsaI GTAC 3 cut(s) 48, 93, 136
RsaNI GTAC 3 cut(s) 47, 92, 135
SaqAI TTAA 3 cut(s) 212, 276, 309
Sau96I GGNCC 1 cut(s) 175
ScaI AGTACT 1 cut(s) 93
SetI ASST 4 cut(s) 149, 211, 276, 282
SgeI CNNG 9 cut(s) 24, 62, 87, 101, 107, 190, 209, 218, 312
SinI GGWCC 1 cut(s) 175
Sse9I AATT 3 cut(s) 123, 257, 310
SspMI CTAG 2 cut(s) 206, 300
StyI CCWWGG 1 cut(s) 196
TasI AATT 3 cut(s) 123, 257, 310
TatI WGTACW 3 cut(s) 46, 91, 134
TfiI GAWTC 1 cut(s) 303
Tru1I TTAA 3 cut(s) 212, 276, 309
Tru9I TTAA 3 cut(s) 212, 276, 309
TspDTI ATGAA 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 175
VspI ATTAAT 1 cut(s) 309
XspI CTAG 2 cut(s) 206, 300
ZrmI AGTACT 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.