Rroxscaffold_5G00358840

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0004847
Physical Location & Seq
Forward (+)
38955976 .. 38961549
5574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00358840.1

Sequence Viewer

Length: 414 bp
ATGTTATTCCCCGATAGTGAGAAAGCGAGAAGAAAGCAGCCGAGAGAAAAAAAGAGAGAGAGGGGTAAGTATCGGTGCAACCCAGCTACAACCGATTGTTACATCAATGTTTTCCTCCATGATCGAGAGATAGAGTCGTCGCTTGGAGGAGTTTTTGATGGTGCAACCCAGGAGAGCACATATAACTTTAATATATTTGGGGGCGGAAGCTCTCTCTATGCCATGTCTTCGAGGCTTCCCAATGATACTTCTACCGAGGGAGAAGGATCGGAGGGTGATGAGCTAAGAAGGAATTCGATGTCATTGAGATCCCTAAAGAAGACAAGTTTCCATGGCTCTAGTGCGTTGAAAAACCCGAAACAATCCTGGAGCATGAGTAAGAGTCTTGCTCATCAACTATTGATTAAAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.42

Weight (kDa)

9.33

Isoelectric Point (pI)

67.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 204
AclWI GGATC 2 cut(s) 274, 303
AcsI RAATTY 1 cut(s) 292
AgsI TTSAA 1 cut(s) 349
AjnI CCWGG 2 cut(s) 168, 365
AluBI AGCT 3 cut(s) 86, 210, 283
AluI AGCT 3 cut(s) 86, 210, 283
Alw21I GWGCWC 1 cut(s) 179
AlwI GGATC 2 cut(s) 274, 303
ApeKI GCWGC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 292
Asp700I GAANNNNTTC 1 cut(s) 292
AsuHPI GGTGA 1 cut(s) 287
BbsI GAAGAC 2 cut(s) 219, 326
Bbv12I GWGCWC 1 cut(s) 179
BbvI GCAGC 1 cut(s) 49
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 2 cut(s) 170, 367
BfaI CTAG 1 cut(s) 339
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
Bme1390I CCNGG 2 cut(s) 170, 367
BmrFI CCNGG 2 cut(s) 170, 367
BpiI GAAGAC 2 cut(s) 219, 326
BplI GAGNNNNNCTC 2 cut(s) 373, 405
BpmI CTGGAG 1 cut(s) 388
BsaJI CCNNGG 3 cut(s) 168, 255, 331
BsaXI ACNNNNNCTCC 2 cut(s) 361, 391
BseBI CCWGG 2 cut(s) 170, 367
BseDI CCNNGG 3 cut(s) 168, 255, 331
BseRI GAGGAG 1 cut(s) 162
BseXI GCAGC 1 cut(s) 49
BseYI CCCAGC 1 cut(s) 82
BsiHKAI GWGCWC 1 cut(s) 179
Bsp1286I GDGCHC 1 cut(s) 179
Bsp143I GATC 3 cut(s) 121, 266, 308
Bsp19I CCATGG 1 cut(s) 331
BspACI CCGC 1 cut(s) 204
BspPI GGATC 2 cut(s) 274, 303
BssECI CCNNGG 3 cut(s) 168, 255, 331
BssMI GATC 3 cut(s) 121, 266, 308
BssT1I CCWWGG 1 cut(s) 331
Bst2UI CCWGG 2 cut(s) 170, 367
BstDEI CTNAG 1 cut(s) 284
BstDSI CCRYGG 1 cut(s) 331
BstKTI GATC 3 cut(s) 124, 269, 311
BstMBI GATC 3 cut(s) 121, 266, 308
BstNI CCWGG 2 cut(s) 170, 367
BstSCI CCNGG 2 cut(s) 168, 365
BstV1I GCAGC 1 cut(s) 49
BstV2I GAAGAC 2 cut(s) 219, 326
BstX2I RGATCY 1 cut(s) 308
BstYI RGATCY 1 cut(s) 308
BtgI CCRYGG 1 cut(s) 331
CviAII CATG 4 cut(s) 119, 223, 332, 373
CviJI RGCY 6 cut(s) 40, 86, 210, 235, 283, 336
CviKI_1 RGCY 6 cut(s) 40, 86, 210, 235, 283, 336
DdeI CTNAG 1 cut(s) 284
DpnI GATC 3 cut(s) 123, 268, 310
DpnII GATC 3 cut(s) 121, 266, 308
EciI GGCGGA 1 cut(s) 219
Eco130I CCWWGG 1 cut(s) 331
EcoRI GAATTC 1 cut(s) 292
EcoRII CCWGG 2 cut(s) 168, 365
EcoT14I CCWWGG 1 cut(s) 331
ErhI CCWWGG 1 cut(s) 331
FaeI CATG 4 cut(s) 122, 226, 335, 376
FaiI YATR 8 cut(s) 120, 181, 183, 194, 219, 224, 333, 374
FatI CATG 4 cut(s) 118, 222, 331, 372
Fnu4HI GCNGC 1 cut(s) 38
Fsp4HI GCNGC 1 cut(s) 38
FspBI CTAG 1 cut(s) 339
GluI GCNGC 1 cut(s) 38
GsaI CCCAGC 1 cut(s) 86
GsuI CTGGAG 1 cut(s) 388
Hin1II CATG 4 cut(s) 122, 226, 335, 376
HinfI GANTC 2 cut(s) 134, 382
HphI GGTGA 1 cut(s) 287
Hpy188I TCNGA 1 cut(s) 271
Hpy188III TCNNGA 1 cut(s) 125
Hpy99I CGWCG 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 257, 282
HpyCH4V TGCA 2 cut(s) 78, 164
HpyF3I CTNAG 1 cut(s) 284
Hsp92II CATG 4 cut(s) 122, 226, 335, 376
Kzo9I GATC 3 cut(s) 121, 266, 308
LmnI GCTCC 1 cut(s) 369
LpnPI CCDG 5 cut(s) 96, 155, 182, 352, 379
Lsp1109I GCAGC 1 cut(s) 49
MaeI CTAG 1 cut(s) 339
MaeIII GTNAC 1 cut(s) 98
MalI GATC 3 cut(s) 123, 268, 310
MboI GATC 3 cut(s) 121, 266, 308
MboII GAAGA 3 cut(s) 42, 219, 331
MflI RGATCY 1 cut(s) 308
MhlI GDGCHC 1 cut(s) 179
MluCI AATT 1 cut(s) 292
MlyI GAGTC 2 cut(s) 143, 391
MnlI CCTC 6 cut(s) 54, 125, 140, 225, 250, 265
MroXI GAANNNNTTC 1 cut(s) 292
MseI TTAA 2 cut(s) 189, 405
MspR9I CCNGG 2 cut(s) 170, 367
MvaI CCWGG 2 cut(s) 170, 367
NcoI CCATGG 1 cut(s) 331
NdeII GATC 3 cut(s) 121, 266, 308
NlaIII CATG 4 cut(s) 122, 226, 335, 376
NmeAIII GCCGAG 1 cut(s) 66
PdmI GAANNNNTTC 1 cut(s) 292
PfoI TCCNGGA 1 cut(s) 365
PkrI GCNGC 1 cut(s) 39
PleI GAGTC 2 cut(s) 142, 390
PpsI GAGTC 2 cut(s) 142, 390
Psp6I CCWGG 2 cut(s) 168, 365
PspFI CCCAGC 1 cut(s) 82
PspGI CCWGG 2 cut(s) 168, 365
PsuI RGATCY 1 cut(s) 308
SaqAI TTAA 2 cut(s) 189, 405
SatI GCNGC 1 cut(s) 38
Sau3AI GATC 3 cut(s) 121, 266, 308
SchI GAGTC 2 cut(s) 143, 391
ScrFI CCNGG 2 cut(s) 170, 367
SduI GDGCHC 1 cut(s) 179
SetI ASST 3 cut(s) 88, 212, 285
Sse9I AATT 1 cut(s) 292
SsiI CCGC 1 cut(s) 204
SspMI CTAG 1 cut(s) 339
StyD4I CCNGG 2 cut(s) 168, 365
StyI CCWWGG 1 cut(s) 331
TaqI TCGA 3 cut(s) 124, 230, 296
TasI AATT 1 cut(s) 292
Tru1I TTAA 2 cut(s) 189, 405
Tru9I TTAA 2 cut(s) 189, 405
TseI GCWGC 1 cut(s) 37
XapI RAATTY 1 cut(s) 292
XmnI GAANNNNTTC 1 cut(s) 292
XspI CTAG 1 cut(s) 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.