Rh4AG177700

Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
44600336 .. 44601625
1290 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG177700.1

Sequence Viewer

Length: 150 bp
ATGATTAAAGCTTCAATCTTTTTACTGGGAGAAGGATCGGAGGATGATGAGCTAAGAAGGAATTCTGATGTCATTGAGATCCTAAAGAAGACAAGTTTCCATGGCTCTAGCATGTTGAAAAACCCAGAAACAACCCTGGAGCATGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.55

Weight (kDa)

5.0

Isoelectric Point (pI)

49.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 43, 73
AcsI RAATTY 1 cut(s) 61
AgsI TTSAA 2 cut(s) 15, 118
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 2 cut(s) 11, 52
AluI AGCT 2 cut(s) 11, 52
AlwI GGATC 2 cut(s) 43, 73
ApoI RAATTY 1 cut(s) 61
Asp700I GAANNNNTTC 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 137
BfaI CTAG 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 137
BmrI ACTGGG 1 cut(s) 35
BmuI ACTGGG 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 95
BsaJI CCNNGG 2 cut(s) 100, 135
BsaXI ACNNNNNCTCC 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 2 cut(s) 100, 135
BseGI GGATG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 30
Bsp143I GATC 2 cut(s) 35, 78
Bsp19I CCATGG 1 cut(s) 100
BspPI GGATC 2 cut(s) 43, 73
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 100, 135
BssMI GATC 2 cut(s) 35, 78
BssT1I CCWWGG 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 53
BstDSI CCRYGG 1 cut(s) 100
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 2 cut(s) 38, 81
BstMBI GATC 2 cut(s) 35, 78
BstNI CCWGG 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 135
BstV2I GAAGAC 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 78
BstYI RGATCY 1 cut(s) 78
BtgI CCRYGG 1 cut(s) 100
BtsCI GGATG 1 cut(s) 49
CviAII CATG 3 cut(s) 101, 112, 143
CviJI RGCY 3 cut(s) 11, 52, 105
CviKI_1 RGCY 3 cut(s) 11, 52, 105
DdeI CTNAG 1 cut(s) 53
DpnI GATC 2 cut(s) 37, 80
DpnII GATC 2 cut(s) 35, 78
Eco130I CCWWGG 1 cut(s) 100
EcoRI GAATTC 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 100
ErhI CCWWGG 1 cut(s) 100
FaeI CATG 3 cut(s) 104, 115, 146
FaiI YATR 3 cut(s) 102, 113, 144
FatI CATG 3 cut(s) 100, 111, 142
FokI GGATG 1 cut(s) 56
FspBI CTAG 1 cut(s) 108
Hin1II CATG 3 cut(s) 104, 115, 146
HindIII AAGCTT 1 cut(s) 9
Hpy188I TCNGA 2 cut(s) 40, 67
HpyAV CCTTC 2 cut(s) 26, 51
HpyF3I CTNAG 1 cut(s) 53
Hsp92II CATG 3 cut(s) 104, 115, 146
Kzo9I GATC 2 cut(s) 35, 78
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 3 cut(s) 11, 122, 138
MaeI CTAG 1 cut(s) 108
MalI GATC 2 cut(s) 37, 80
MboI GATC 2 cut(s) 35, 78
MboII GAAGA 1 cut(s) 100
MflI RGATCY 1 cut(s) 78
MluCI AATT 1 cut(s) 61
MnlI CCTC 1 cut(s) 34
MroXI GAANNNNTTC 1 cut(s) 61
MseI TTAA 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
NcoI CCATGG 1 cut(s) 100
NdeII GATC 2 cut(s) 35, 78
NlaIII CATG 3 cut(s) 104, 115, 146
NspI RCATGY 1 cut(s) 115
PdmI GAANNNNTTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PsuI RGATCY 1 cut(s) 78
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 2 cut(s) 35, 78
ScrFI CCNGG 1 cut(s) 137
SetI ASST 2 cut(s) 13, 54
SgeI CNNG 6 cut(s) 38, 105, 113, 120, 124, 137
Sse9I AATT 1 cut(s) 61
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 100
TasI AATT 1 cut(s) 61
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
XapI RAATTY 1 cut(s) 61
XceI RCATGY 1 cut(s) 115
XmnI GAANNNNTTC 1 cut(s) 61
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.