Rroxscaffold_5G00366060

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
47825612 .. 47826305
694 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00366060.1

Sequence Viewer

Length: 195 bp
ATGCTTCACTTAGCTATATTCACTTCCTTCCCCGAGGTTGATCTTCTTGATGGTTCCAACTCCTCCATCTCCTTCAAGAATCTCGGCACTTTTAACTGCTTGGGGAGCAATCTTGGGGATGAGGTTGTCGGCATCAAGAACAAAGGCCTTGAACAACCTAGCAGGGGGATGACAGAGGTGAACTCGGTTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.82

Weight (kDa)

4.7

Isoelectric Point (pI)

28.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 76, 152
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
Ama87I CYCGRG 1 cut(s) 32
AoxI GGCC 1 cut(s) 145
AsuHPI GGTGA 1 cut(s) 190
AvaI CYCGRG 1 cut(s) 32
BccI CCATC 2 cut(s) 44, 74
BfaI CTAG 1 cut(s) 159
BmeT110I CYCGRG 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 55
BmsI GCATC 1 cut(s) 141
BplI GAGNNNNNCTC 1 cut(s) 167
BsaJI CCNNGG 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 2 cut(s) 124, 174
BseLI CCNNNNNNNGG 1 cut(s) 164
BseRI GAGGAG 1 cut(s) 52
BshFI GGCC 1 cut(s) 147
BsiHKCI CYCGRG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 164
BsnI GGCC 1 cut(s) 147
BsoBI CYCGRG 1 cut(s) 32
Bsp143I GATC 1 cut(s) 40
BspANI GGCC 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 10
BstF5I GGATG 2 cut(s) 124, 174
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 147
BtsCI GGATG 2 cut(s) 124, 174
CviJI RGCY 2 cut(s) 14, 147
CviKI_1 RGCY 2 cut(s) 14, 147
DdeI CTNAG 1 cut(s) 10
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco147I AGGCCT 1 cut(s) 147
Eco88I CYCGRG 1 cut(s) 32
FaiI YATR 2 cut(s) 17, 193
FokI GGATG 2 cut(s) 131, 181
FspBI CTAG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 147
HinfI GANTC 1 cut(s) 79
HphI GGTGA 1 cut(s) 190
Hpy166II GTNNAC 1 cut(s) 181
Hpy188III TCNNGA 3 cut(s) 47, 76, 136
Hpy8I GTNNAC 1 cut(s) 181
HpyAV CCTTC 2 cut(s) 37, 82
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 10
Kzo9I GATC 1 cut(s) 40
LmnI GCTCC 1 cut(s) 105
LpnPI CCDG 1 cut(s) 148
LweI GCATC 1 cut(s) 141
MaeI CTAG 1 cut(s) 159
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 1 cut(s) 35
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 4 cut(s) 28, 73, 115, 169
MseI TTAA 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 105
NdeII GATC 1 cut(s) 40
NlaIV GGNNCC 1 cut(s) 55
NmeAIII GCCGAG 1 cut(s) 63
PceI AGGCCT 1 cut(s) 147
PfeI GAWTC 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 55
SaqAI TTAA 1 cut(s) 93
Sau3AI GATC 1 cut(s) 40
SetI ASST 5 cut(s) 16, 39, 126, 160, 180
SfaNI GCATC 1 cut(s) 141
SseBI AGGCCT 1 cut(s) 147
SspMI CTAG 1 cut(s) 159
StuI AGGCCT 1 cut(s) 147
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 180
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.