Rroxscaffold_5G00366780

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
48700069 .. 48700682
614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00366780.1

Sequence Viewer

Length: 339 bp
ATGGCATCACGCCCGAAGCAAAAGATTTCTGATGAATTCAAAGACATCCCCATCGCGGATGAAAAAGGCAAGGGCTTAGTGCCATCACAGTCTGCTTCTGAGAACGGCGAAGGTGAGCGAAAGAAGAACGGCAAAGGTGAGCAAAAGAAGAACGGCAAAGGTGAGCAAAAGACGAATGACAATGAGAAAAAGGAAGGCAACGGGAACGCTGATGCTATCACGGTTCAGGGCAACGAAATCAATAATCAAGGTCCAGCTAAAAATGTCGGAGTTTTTGGATTTGCTAACAGGCAGTACAAGCAGTATTATGGCCGCAAAGAGTCAGGTGATGAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.25

Weight (kDa)

8.73

Isoelectric Point (pI)

19.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 56
AciI CCGC 2 cut(s) 56, 313
AcoI YGGCCR 1 cut(s) 310
AcsI RAATTY 1 cut(s) 35
AfaI GTAC 1 cut(s) 296
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 40
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
AoxI GGCC 1 cut(s) 310
ApoI RAATTY 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 251
AsuHPI GGTGA 4 cut(s) 125, 149, 173, 338
AvaII GGWCC 1 cut(s) 251
BccI CCATC 2 cut(s) 59, 91
BceAI ACGGC 3 cut(s) 121, 145, 169
BisI GCNGC 1 cut(s) 313
BlsI GCNGC 1 cut(s) 314
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
BmsI GCATC 2 cut(s) 14, 202
Bsc4I CCNNNNNNNGG 1 cut(s) 55
BseGI GGATG 2 cut(s) 45, 64
BseLI CCNNNNNNNGG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 90
Bsh1236I CGCG 1 cut(s) 56
BshFI GGCC 1 cut(s) 312
BslI CCNNNNNNNGG 1 cut(s) 55
BsnI GGCC 1 cut(s) 312
BspACI CCGC 2 cut(s) 56, 313
BspANI GGCC 1 cut(s) 312
BspCNI CTCAG 1 cut(s) 91
BspFNI CGCG 1 cut(s) 56
Bst4CI ACNGT 2 cut(s) 90, 223
BstDEI CTNAG 2 cut(s) 76, 99
BstF5I GGATG 2 cut(s) 45, 64
BstFNI CGCG 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 298
BstUI CGCG 1 cut(s) 56
BsuRI GGCC 1 cut(s) 312
BtgZI GCGATG 1 cut(s) 37
BtsCI GGATG 2 cut(s) 45, 64
Cfr13I GGNCC 1 cut(s) 251
Csp6I GTAC 1 cut(s) 295
CviJI RGCY 3 cut(s) 75, 257, 312
CviKI_1 RGCY 3 cut(s) 75, 257, 312
CviQI GTAC 1 cut(s) 295
DdeI CTNAG 2 cut(s) 76, 99
EaeI YGGCCR 1 cut(s) 310
Eco47I GGWCC 1 cut(s) 251
EcoRI GAATTC 1 cut(s) 35
FaiI YATR 1 cut(s) 309
Fnu4HI GCNGC 1 cut(s) 313
FokI GGATG 2 cut(s) 32, 71
Fsp4HI GCNGC 1 cut(s) 313
GluI GCNGC 1 cut(s) 313
HaeIII GGCC 1 cut(s) 312
HinfI GANTC 1 cut(s) 320
HphI GGTGA 4 cut(s) 125, 149, 173, 338
Hpy188I TCNGA 3 cut(s) 31, 100, 269
HpyAV CCTTC 2 cut(s) 104, 188
HpyCH4III ACNGT 2 cut(s) 90, 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 298
HpyF3I CTNAG 2 cut(s) 76, 99
LpnPI CCDG 4 cut(s) 212, 267, 274, 309
LweI GCATC 2 cut(s) 14, 202
MboII GAAGA 2 cut(s) 136, 160
MluCI AATT 1 cut(s) 35
MlyI GAGTC 1 cut(s) 329
MmeI TCCRAC 1 cut(s) 247
MvnI CGCG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 298
PkrI GCNGC 1 cut(s) 314
PleI GAGTC 1 cut(s) 328
PpsI GAGTC 1 cut(s) 328
PspPI GGNCC 1 cut(s) 251
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SatI GCNGC 1 cut(s) 313
Sau96I GGNCC 1 cut(s) 251
SchI GAGTC 1 cut(s) 329
SetI ASST 6 cut(s) 115, 139, 163, 253, 259, 328
SfaNI GCATC 2 cut(s) 14, 202
SinI GGWCC 1 cut(s) 251
Sse9I AATT 1 cut(s) 35
SsiI CCGC 2 cut(s) 56, 313
TaaI ACNGT 2 cut(s) 90, 223
TasI AATT 1 cut(s) 35
TatI WGTACW 1 cut(s) 294
TauI GCSGC 1 cut(s) 315
TspDTI ATGAA 2 cut(s) 48, 75
VpaK11BI GGWCC 1 cut(s) 251
XapI RAATTY 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.