Rh4DG256600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
47269101 .. 47269298
198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG256600.1

Sequence Viewer

Length: 198 bp
ATGCTGGATACTATTGAGGTTCCTGATGCTATCACGGTTCAGGAAATTGGAAGGCAAAGGGAGAAAAAGGAAGGCAAAGGGAGCGCTGATGCTATCACGGTTCAGGAAAACGAAATCAATAATCAAGGTACAGCTGAAAGTGTCGGAGTTTTTGACTTTGCTAACAAGCAGTATTTTGGCGCCAAATCTGAAGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.07

Weight (kDa)

4.49

Isoelectric Point (pI)

34.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 179
AcyI GRCGYC 1 cut(s) 180
AfaI GTAC 1 cut(s) 130
AfeI AGCGCT 1 cut(s) 85
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
Aor51HI AGCGCT 1 cut(s) 85
AspLEI GCGC 2 cut(s) 86, 182
BanI GGYRCC 1 cut(s) 179
BfoI RGCGCY 2 cut(s) 87, 183
BmiI GGNNCC 2 cut(s) 21, 181
BmsI GCATC 2 cut(s) 16, 79
BsaHI GRCGYC 1 cut(s) 180
BshNI GGYRCC 1 cut(s) 179
BspLI GGNNCC 2 cut(s) 21, 181
BspT107I GGYRCC 1 cut(s) 179
BssNI GRCGYC 1 cut(s) 180
Bst4CI ACNGT 2 cut(s) 37, 100
BstACI GRCGYC 1 cut(s) 180
BstH2I RGCGCY 2 cut(s) 87, 183
BstHHI GCGC 2 cut(s) 86, 182
BstMWI GCNNNNNNNGC 1 cut(s) 81
CfoI GCGC 2 cut(s) 86, 182
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
CviQI GTAC 1 cut(s) 129
DinI GGCGCC 1 cut(s) 181
Eco47III AGCGCT 1 cut(s) 85
EgeI GGCGCC 1 cut(s) 181
EheI GGCGCC 1 cut(s) 181
GlaI GCGC 2 cut(s) 85, 181
HaeII RGCGCY 2 cut(s) 87, 183
HhaI GCGC 2 cut(s) 86, 182
Hin1I GRCGYC 1 cut(s) 180
Hin6I GCGC 2 cut(s) 84, 180
HinP1I GCGC 2 cut(s) 84, 180
Hpy188I TCNGA 2 cut(s) 146, 190
Hpy188III TCNNGA 3 cut(s) 23, 41, 104
HpyAV CCTTC 2 cut(s) 45, 65
HpyCH4III ACNGT 2 cut(s) 37, 100
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
Hsp92I GRCGYC 1 cut(s) 180
HspAI GCGC 2 cut(s) 84, 180
KasI GGCGCC 1 cut(s) 179
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 3 cut(s) 26, 36, 89
LweI GCATC 2 cut(s) 16, 79
MluCI AATT 1 cut(s) 45
Mly113I GGCGCC 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 124
MnlI CCTC 1 cut(s) 10
MspA1I CMGCKG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 81
NarI GGCGCC 1 cut(s) 180
NlaIV GGNNCC 2 cut(s) 21, 181
PluTI GGCGCC 1 cut(s) 183
PspN4I GGNNCC 2 cut(s) 21, 181
PvuII CAGCTG 1 cut(s) 134
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SetI ASST 3 cut(s) 21, 130, 136
SfaNI GCATC 2 cut(s) 16, 79
SfoI GGCGCC 1 cut(s) 181
SgeI CNNG 8 cut(s) 17, 35, 46, 53, 109, 116, 137, 178
Sse9I AATT 1 cut(s) 45
SspDI GGCGCC 1 cut(s) 179
TaaI ACNGT 2 cut(s) 37, 100
TasI AATT 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.