Rh4DG257400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
47417149 .. 47417451
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG257400.1

Sequence Viewer

Length: 303 bp
ATGGCATCAGGCCATTCTGATGAATACAAAGACATCCCCGTACATGAACCTGGCGAGGGCTCAAGGCCACCACAGCCTGCTTCTGAGAAAGGCAAAGGTGAGCGAAAGAAGAACGGCAAAGGTGAGCAAAAGACGAATGGCAATAAGAAAAAGGAAGGCAAACGGAACGCTGATGTTATCACGGTTCAGGACAACAACATCAATAATCAAGGTAAAGCTAAAAAATGCGGAGTTTTTGGATTTGCTAACAAGCAGTATTATGGCCCCAAAGAGTCAAGTGAAGAAGAAAGTGAGTCCGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

10.95

Weight (kDa)

8.61

Isoelectric Point (pI)

52.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 228
AfaI GTAC 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 56
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
AoxI GGCC 3 cut(s) 10, 65, 262
AspS9I GGNCC 1 cut(s) 263
AsuHPI GGTGA 2 cut(s) 110, 134
BanII GRGCYC 1 cut(s) 62
BceAI ACGGC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 263
BmiI GGNNCC 1 cut(s) 265
BmrFI CCNGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 14
BpuEI CTTGAG 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 51
BseGI GGATG 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 56
BseMII CTCAG 1 cut(s) 75
BshFI GGCC 3 cut(s) 12, 67, 264
BslI CCNNNNNNNGG 1 cut(s) 56
BsnI GGCC 3 cut(s) 12, 67, 264
Bsp1286I GDGCHC 1 cut(s) 62
BspACI CCGC 1 cut(s) 228
BspANI GGCC 3 cut(s) 12, 67, 264
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 265
Bst2UI CCWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 184
BstC8I GCNNGC 1 cut(s) 78
BstDEI CTNAG 1 cut(s) 84
BstF5I GGATG 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BsuRI GGCC 3 cut(s) 12, 67, 264
BtsCI GGATG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 78
Cfr13I GGNCC 1 cut(s) 263
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 44
CviJI RGCY 6 cut(s) 12, 60, 67, 76, 218, 264
CviKI_1 RGCY 6 cut(s) 12, 60, 67, 76, 218, 264
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 1 cut(s) 84
Eco24I GRGCYC 1 cut(s) 62
EcoRII CCWGG 1 cut(s) 49
EcoT38I GRGCYC 1 cut(s) 62
FaeI CATG 1 cut(s) 47
FaiI YATR 2 cut(s) 45, 261
FatI CATG 1 cut(s) 43
FokI GGATG 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 62
HaeIII GGCC 3 cut(s) 12, 67, 264
Hin1II CATG 1 cut(s) 47
HinfI GANTC 2 cut(s) 272, 293
HphI GGTGA 2 cut(s) 110, 134
Hpy188I TCNGA 3 cut(s) 19, 85, 298
Hpy188III TCNNGA 1 cut(s) 188
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 1 cut(s) 47
LpnPI CCDG 4 cut(s) 36, 63, 90, 173
LweI GCATC 1 cut(s) 14
MboII GAAGA 3 cut(s) 121, 293, 296
MhlI GDGCHC 1 cut(s) 62
MlyI GAGTC 2 cut(s) 281, 302
MnlI CCTC 1 cut(s) 49
MslI CAYNNNNRTG 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
MwoI GCNNNNNNNGC 1 cut(s) 73
NlaIII CATG 1 cut(s) 47
NlaIV GGNNCC 1 cut(s) 265
PleI GAGTC 2 cut(s) 280, 301
PpsI GAGTC 2 cut(s) 280, 301
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PspN4I GGNNCC 1 cut(s) 265
PspPI GGNCC 1 cut(s) 263
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 263
SchI GAGTC 2 cut(s) 281, 302
ScrFI CCNGG 1 cut(s) 51
SduI GDGCHC 1 cut(s) 62
SetI ASST 5 cut(s) 52, 100, 124, 214, 220
SfaNI GCATC 1 cut(s) 14
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
SsiI CCGC 1 cut(s) 228
StyD4I CCNGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 184
TspDTI ATGAA 2 cut(s) 36, 60
TspGWI ACGGA 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.