Rroxscaffold_6G00405380

Tetratricopeptide repeat

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
27766956 .. 27767369
414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00405380.1

Sequence Viewer

Length: 165 bp
ATGGCAGACATTACATACAATGGACACAGAAGCCATTCTATTGTGTTGTTGTTCTTGTTGGTTACTAAGAAACCTAACAACAAAGTGGCGCAACCACAGCGAGATGCTTTGAAGGAACAAGTGAAATTGTACAGAGATGTCCCCGTTAAAACAAAGGAGAGATAA

Protein Analysis

54

Amino Acids

6.29

Weight (kDa)

10.09

Isoelectric Point (pI)

23.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 131
AgsI TTSAA 1 cut(s) 112
Asp700I GAANNNNTTC 1 cut(s) 34
AspLEI GCGC 1 cut(s) 91
BmsI GCATC 1 cut(s) 94
BslFI GGGAC 1 cut(s) 125
BsmFI GGGAC 1 cut(s) 125
Bsp1407I TGTACA 1 cut(s) 129
BsrGI TGTACA 1 cut(s) 129
BstAUI TGTACA 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 66
BstHHI GCGC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 97
CfoI GCGC 1 cut(s) 91
Csp6I GTAC 1 cut(s) 130
CviJI RGCY 1 cut(s) 33
CviKI_1 RGCY 1 cut(s) 33
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 66
FaiI YATR 1 cut(s) 16
FaqI GGGAC 1 cut(s) 125
GlaI GCGC 1 cut(s) 90
HhaI GCGC 1 cut(s) 91
Hin6I GCGC 1 cut(s) 89
HinP1I GCGC 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 66
HspAI GCGC 1 cut(s) 89
LweI GCATC 1 cut(s) 94
MaeIII GTNAC 1 cut(s) 61
MluCI AATT 1 cut(s) 125
MroXI GAANNNNTTC 1 cut(s) 34
MseI TTAA 1 cut(s) 147
MwoI GCNNNNNNNGC 1 cut(s) 97
PdmI GAANNNNTTC 1 cut(s) 34
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 147
SetI ASST 1 cut(s) 76
SfaNI GCATC 1 cut(s) 94
SgeI CNNG 4 cut(s) 67, 113, 131, 155
Sse9I AATT 1 cut(s) 125
TasI AATT 1 cut(s) 125
TatI WGTACW 1 cut(s) 129
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
XmnI GAANNNNTTC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.