Rroxscaffold_7G00177930

Type I inositol 1,4,5-trisphosphate 5-phosphatase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
17521814 .. 17525517
3704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00177930.1

Sequence Viewer

Length: 225 bp
ATGGCAACCATGAATGCTCAAATGACAGAATTTCATGGGTTGTTGGAAGGAACGAACAACAACAACAACTGTAACAGAGGCGGAGAAGGACAAAAAGTGCTAGAGCACCACATGGTGGTGGAGGTAGGGCTTGAAAGGAGTTCTGTTGGGCATTGGTGGCTAGATAATATAGGAAAGACTTTTGAAGAAGGAAAAACTTATGAATGTATGGGTTCGGGCAGCTAG

Protein Analysis

74

Amino Acids

8.2

Weight (kDa)

5.17

Isoelectric Point (pI)

32.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 115
AciI CCGC 1 cut(s) 81
AcsI RAATTY 1 cut(s) 29
AdeI CACNNNGTG 1 cut(s) 115
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 2 cut(s) 134, 185
AluBI AGCT 1 cut(s) 222
AluI AGCT 1 cut(s) 222
Alw21I GWGCWC 1 cut(s) 108
ApeKI GCWGC 1 cut(s) 219
ApoI RAATTY 1 cut(s) 29
Bbv12I GWGCWC 1 cut(s) 108
BfaI CTAG 3 cut(s) 101, 161, 223
BisI GCNGC 1 cut(s) 220
BlsI GCNGC 1 cut(s) 221
Bsc4I CCNNNNNNNGG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 115
BsiHKAI GWGCWC 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 115
BsmI GAATGC 1 cut(s) 19
Bsp1286I GDGCHC 1 cut(s) 108
BspACI CCGC 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 71
BstMWI GCNNNNNNNGC 1 cut(s) 157
CviAII CATG 3 cut(s) 10, 35, 112
CviJI RGCY 3 cut(s) 130, 160, 222
CviKI_1 RGCY 3 cut(s) 130, 160, 222
DraIII CACNNNGTG 1 cut(s) 115
EciI GGCGGA 1 cut(s) 96
FaeI CATG 3 cut(s) 13, 38, 115
FaiI YATR 6 cut(s) 11, 36, 113, 170, 201, 209
FatI CATG 3 cut(s) 9, 34, 111
Fnu4HI GCNGC 1 cut(s) 220
Fsp4HI GCNGC 1 cut(s) 220
FspBI CTAG 3 cut(s) 101, 161, 223
GluI GCNGC 1 cut(s) 220
Hin1II CATG 3 cut(s) 13, 38, 115
HpyAV CCTTC 3 cut(s) 41, 80, 182
HpyCH4III ACNGT 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
Hsp92II CATG 3 cut(s) 13, 38, 115
MaeI CTAG 3 cut(s) 101, 161, 223
MaeIII GTNAC 1 cut(s) 71
MboII GAAGA 1 cut(s) 197
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 1 cut(s) 29
MmeI TCCRAC 1 cut(s) 24
MnlI CCTC 2 cut(s) 71, 115
MslI CAYNNNNRTG 1 cut(s) 116
Mva1269I GAATGC 1 cut(s) 19
MwoI GCNNNNNNNGC 1 cut(s) 157
NlaIII CATG 3 cut(s) 13, 38, 115
PctI GAATGC 1 cut(s) 19
PflMI CCANNNNNTGG 1 cut(s) 115
PkrI GCNGC 1 cut(s) 221
RseI CAYNNNNRTG 1 cut(s) 116
SatI GCNGC 1 cut(s) 220
SduI GDGCHC 1 cut(s) 108
SetI ASST 2 cut(s) 126, 224
SgeI CNNG 6 cut(s) 22, 47, 113, 124, 143, 173
SmiMI CAYNNNNRTG 1 cut(s) 116
Sse9I AATT 1 cut(s) 29
SsiI CCGC 1 cut(s) 81
SspMI CTAG 3 cut(s) 101, 161, 223
TaaI ACNGT 1 cut(s) 71
TasI AATT 1 cut(s) 29
TseI GCWGC 1 cut(s) 219
TspDTI ATGAA 3 cut(s) 23, 26, 216
Van91I CCANNNNNTGG 1 cut(s) 115
XapI RAATTY 1 cut(s) 29
XspI CTAG 3 cut(s) 101, 161, 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.