Rroxscaffold_7G00179170

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
18795680 .. 18796332
653 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00179170.1

Sequence Viewer

Length: 225 bp
ATGAACGCTCAAATGACAGAATTTTGTGGGTTGTTGGAAGGAACGAACAACAACAACAACTGTAATAGAGAGTTCTCGTCGAGGCAAGGAAAAGAGCGTGTTTGGATATGGCGTAAGATGAAAGGTCTTCTTAGCGAAAAATTTATGCCTAGAGATTTTTCAATCAAGAATCACTATCCTAAGGTTTTTGAGAAGAAGTTAAAGTCCAAAACCAAAGCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.79

Weight (kDa)

10.02

Isoelectric Point (pI)

27.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 20, 140
AgsI TTSAA 1 cut(s) 162
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
ApoI RAATTY 2 cut(s) 20, 140
AxyI CCTNAGG 1 cut(s) 180
BbsI GAAGAC 1 cut(s) 119
BfaI CTAG 1 cut(s) 150
BpiI GAAGAC 1 cut(s) 119
Bse21I CCTNAGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 62
BstDEI CTNAG 2 cut(s) 131, 180
BstV2I GAAGAC 1 cut(s) 119
Bsu36I CCTNAGG 1 cut(s) 180
CviJI RGCY 1 cut(s) 218
CviKI_1 RGCY 1 cut(s) 218
DdeI CTNAG 2 cut(s) 131, 180
Eco81I CCTNAGG 1 cut(s) 180
FaiI YATR 2 cut(s) 109, 146
FalI AAGNNNNNCTT 2 cut(s) 114, 146
FspBI CTAG 1 cut(s) 150
HindIII AAGCTT 1 cut(s) 216
HinfI GANTC 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 166, 222
Hpy99I CGWCG 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 62
HpyF3I CTNAG 2 cut(s) 131, 180
MaeI CTAG 1 cut(s) 150
MboII GAAGA 2 cut(s) 119, 205
MluCI AATT 2 cut(s) 20, 140
MmeI TCCRAC 1 cut(s) 15
MnlI CCTC 1 cut(s) 75
MseI TTAA 1 cut(s) 200
PfeI GAWTC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 200
SetI ASST 3 cut(s) 127, 186, 220
SgeI CNNG 6 cut(s) 88, 93, 98, 110, 162, 178
Sse9I AATT 2 cut(s) 20, 140
SspMI CTAG 1 cut(s) 150
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 80
TasI AATT 2 cut(s) 20, 140
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TspDTI ATGAA 2 cut(s) 17, 134
XapI RAATTY 2 cut(s) 20, 140
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.