Rroxscaffold_7G00180320

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
19762963 .. 19763994
1032 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00180320.1

Sequence Viewer

Length: 174 bp
ATGGCTGTGATTATCTTGCTACATGGGCATGTGCTTGGGTTTGGGCTCACTTCTTGGCCTGCCCAAGTTAGCATCCTTGAGACTCTCCGGCTCGGAAGTGCCATTACGTCGAGTGACATCAACGACCTCCTCGGCTCGCTCTCCAAGGATCGTCACTTCATCTACGCCAATTAG

Protein Analysis

57

Amino Acids

6.16

Weight (kDa)

6.22

Isoelectric Point (pI)

30.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 156
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 156
AoxI GGCC 1 cut(s) 56
BanII GRGCYC 1 cut(s) 48
BarI GAAGNNNNNNTAC 2 cut(s) 88, 120
BcoDI GTCTC 1 cut(s) 74
BmsI GCATC 1 cut(s) 81
BpuEI CTTGAG 1 cut(s) 98
BsaJI CCNNGG 2 cut(s) 130, 144
BseDI CCNNGG 2 cut(s) 130, 144
BseGI GGATG 1 cut(s) 72
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 1 cut(s) 58
BsiSI CCGG 1 cut(s) 88
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 1 cut(s) 58
Bsp1286I GDGCHC 1 cut(s) 48
Bsp143I GATC 1 cut(s) 148
BspANI GGCC 1 cut(s) 58
BspPI GGATC 1 cut(s) 156
BssECI CCNNGG 2 cut(s) 130, 144
BssMI GATC 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 144
BstC8I GCNNGC 2 cut(s) 60, 137
BstF5I GGATG 1 cut(s) 72
BstKTI GATC 1 cut(s) 151
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstNSI RCATGY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 58
BtsCI GGATG 1 cut(s) 72
Cac8I GCNNGC 2 cut(s) 60, 137
CviAII CATG 2 cut(s) 23, 29
CviJI RGCY 5 cut(s) 5, 46, 58, 91, 135
CviKI_1 RGCY 5 cut(s) 5, 46, 58, 91, 135
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eco130I CCWWGG 1 cut(s) 144
Eco24I GRGCYC 1 cut(s) 48
EcoT14I CCWWGG 1 cut(s) 144
EcoT38I GRGCYC 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 2 cut(s) 26, 32
FaiI YATR 2 cut(s) 24, 30
FatI CATG 2 cut(s) 22, 28
FokI GGATG 1 cut(s) 59
FriOI GRGCYC 1 cut(s) 48
HaeIII GGCC 1 cut(s) 58
HapII CCGG 1 cut(s) 88
Hin1II CATG 2 cut(s) 26, 32
HinfI GANTC 1 cut(s) 82
HpaII CCGG 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 95
Hpy99I CGWCG 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
HpySE526I ACGT 1 cut(s) 107
Hsp92II CATG 2 cut(s) 26, 32
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 2 cut(s) 72, 101
LweI GCATC 1 cut(s) 81
MaeII ACGT 1 cut(s) 107
MaeIII GTNAC 2 cut(s) 113, 152
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MhlI GDGCHC 1 cut(s) 48
MluCI AATT 1 cut(s) 169
MlyI GAGTC 1 cut(s) 76
MnlI CCTC 2 cut(s) 137, 140
MslI CAYNNNNRTG 1 cut(s) 27
MspI CCGG 1 cut(s) 88
MwoI GCNNNNNNNGC 1 cut(s) 25
NdeII GATC 1 cut(s) 148
NlaIII CATG 2 cut(s) 26, 32
NmeAIII GCCGAG 1 cut(s) 111
NmuCI GTSAC 2 cut(s) 113, 152
NspI RCATGY 1 cut(s) 32
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
RseI CAYNNNNRTG 1 cut(s) 27
Sau3AI GATC 1 cut(s) 148
SchI GAGTC 1 cut(s) 76
SduI GDGCHC 1 cut(s) 48
SetI ASST 2 cut(s) 110, 129
SfaNI GCATC 1 cut(s) 81
SmiMI CAYNNNNRTG 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 1 cut(s) 169
StyI CCWWGG 1 cut(s) 144
TaiI ACGT 1 cut(s) 110
TaqI TCGA 1 cut(s) 110
TasI AATT 1 cut(s) 169
TseFI GTSAC 2 cut(s) 113, 152
Tsp45I GTSAC 2 cut(s) 113, 152
TspDTI ATGAA 1 cut(s) 148
XceI RCATGY 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.