Rroxscaffold_7G00215750

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0006047
Physical Location & Seq
Forward (+)
66314130 .. 66316887
2758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00215750.1

Sequence Viewer

Length: 279 bp
ATGTTTCAATCCCGGCGAGAGTTTCCAATTGTCGGCGGAACTGGTGATTTCCGGTTGGCTCGTGGATTTGCGTCGGCCTCGACCTATATTGCTAATGCCAGTCTTGCTATTGTGGAATATAATGTTACGTGTCTCTTAAGAAGATCGAGAAAGGTGGGACGTCCACTTGGAGCTCATAACAAACCAAAAGTGGAGGATCTAAATTCCTTGAAGTCGAAGTCCGCATCATCTCGTGGCGGAGGCATAGAAAAGGAAGAAGAGAAAGTTCACTTGAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

92

Amino Acids

10.05

Weight (kDa)

10.09

Isoelectric Point (pI)

55.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 2 - 44 1.8e-11 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 163
AciI CCGC 3 cut(s) 36, 222, 237
AclWI GGATC 1 cut(s) 204
AcsI RAATTY 1 cut(s) 202
AcyI GRCGYC 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 32
AflII CTTAAG 1 cut(s) 136
AflIII ACRYGT 1 cut(s) 128
AgsI TTSAA 2 cut(s) 8, 211
AluBI AGCT 2 cut(s) 173, 276
AluI AGCT 2 cut(s) 173, 276
Alw21I GWGCWC 1 cut(s) 175
Alw26I GTCTC 1 cut(s) 137
AlwI GGATC 1 cut(s) 204
AoxI GGCC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 202
AsuC2I CCSGG 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 56
BanII GRGCYC 1 cut(s) 175
BauI CACGAG 2 cut(s) 60, 231
Bbv12I GWGCWC 1 cut(s) 175
BcnI CCSGG 1 cut(s) 13
BcoDI GTCTC 1 cut(s) 137
BfaI CTAG 1 cut(s) 277
BfrI CTTAAG 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 13
BmrFI CCNGG 1 cut(s) 13
BmsI GCATC 1 cut(s) 233
BpuMI CCSGG 1 cut(s) 13
BsaAI YACGTR 1 cut(s) 129
BsaHI GRCGYC 1 cut(s) 160
BsaWI WCCGGW 1 cut(s) 51
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse1I ACTGG 2 cut(s) 46, 99
BseLI CCNNNNNNNGG 1 cut(s) 32
BseNI ACTGG 2 cut(s) 46, 99
BshFI GGCC 1 cut(s) 77
BsiHKAI GWGCWC 1 cut(s) 175
BsiSI CCGG 2 cut(s) 13, 52
BslFI GGGAC 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 32
BsmAI GTCTC 1 cut(s) 137
BsmFI GGGAC 1 cut(s) 171
BsnI GGCC 1 cut(s) 77
Bsp1286I GDGCHC 1 cut(s) 175
Bsp143I GATC 2 cut(s) 143, 196
BspACI CCGC 3 cut(s) 36, 222, 237
BspANI GGCC 1 cut(s) 77
BspPI GGATC 1 cut(s) 204
BspTI CTTAAG 1 cut(s) 136
BsrI ACTGG 2 cut(s) 46, 99
BssMI GATC 2 cut(s) 143, 196
BssNI GRCGYC 1 cut(s) 160
BssSI CACGAG 2 cut(s) 60, 231
Bst2BI CACGAG 2 cut(s) 60, 231
Bst6I CTCTTC 1 cut(s) 252
BstACI GRCGYC 1 cut(s) 160
BstAFI CTTAAG 1 cut(s) 136
BstBAI YACGTR 1 cut(s) 129
BstKTI GATC 2 cut(s) 146, 199
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 2 cut(s) 143, 196
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 11
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BsuRI GGCC 1 cut(s) 77
CseI GACGC 1 cut(s) 60
CviJI RGCY 4 cut(s) 59, 77, 173, 276
CviKI_1 RGCY 4 cut(s) 59, 77, 173, 276
DpnI GATC 2 cut(s) 145, 198
DpnII GATC 2 cut(s) 143, 196
Eam1104I CTCTTC 1 cut(s) 252
EarI CTCTTC 1 cut(s) 252
EciI GGCGGA 2 cut(s) 51, 252
Ecl136II GAGCTC 1 cut(s) 173
Eco24I GRGCYC 1 cut(s) 175
Eco53kI GAGCTC 1 cut(s) 173
EcoICRI GAGCTC 1 cut(s) 173
EcoT38I GRGCYC 1 cut(s) 175
FaiI YATR 4 cut(s) 87, 120, 177, 245
FaqI GGGAC 1 cut(s) 171
FriOI GRGCYC 1 cut(s) 175
FspBI CTAG 1 cut(s) 277
HaeIII GGCC 1 cut(s) 77
HapII CCGG 2 cut(s) 13, 52
HgaI GACGC 1 cut(s) 60
Hin1I GRCGYC 1 cut(s) 160
HpaII CCGG 2 cut(s) 13, 52
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 2 cut(s) 164, 268
Hpy188III TCNNGA 1 cut(s) 147
Hpy8I GTNNAC 2 cut(s) 164, 268
Hpy99I CGWCG 1 cut(s) 76
HpyCH4IV ACGT 2 cut(s) 128, 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpySE526I ACGT 2 cut(s) 128, 160
Hsp92I GRCGYC 1 cut(s) 160
Kzo9I GATC 2 cut(s) 143, 196
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 4 cut(s) 26, 27, 65, 112
LweI GCATC 1 cut(s) 233
MaeI CTAG 1 cut(s) 277
MaeII ACGT 2 cut(s) 128, 160
MaeIII GTNAC 1 cut(s) 124
MalI GATC 2 cut(s) 145, 198
MboI GATC 2 cut(s) 143, 196
MboII GAAGA 3 cut(s) 153, 266, 269
MfeI CAATTG 1 cut(s) 27
MflI RGATCY 1 cut(s) 196
MhlI GDGCHC 1 cut(s) 175
MluCI AATT 2 cut(s) 27, 202
MnlI CCTC 3 cut(s) 88, 187, 233
MseI TTAA 1 cut(s) 137
MspCI CTTAAG 1 cut(s) 136
MspI CCGG 2 cut(s) 13, 52
MspR9I CCNGG 1 cut(s) 13
MunI CAATTG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 104
NciI CCSGG 1 cut(s) 13
NdeII GATC 2 cut(s) 143, 196
Ppu21I YACGTR 1 cut(s) 129
Psp124BI GAGCTC 1 cut(s) 175
PsuI RGATCY 1 cut(s) 196
SacI GAGCTC 1 cut(s) 175
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 2 cut(s) 143, 196
ScrFI CCNGG 1 cut(s) 13
SduI GDGCHC 1 cut(s) 175
SetI ASST 6 cut(s) 86, 131, 156, 163, 175, 278
SfaNI GCATC 1 cut(s) 233
SmlI CTYRAG 2 cut(s) 136, 271
SmoI CTYRAG 2 cut(s) 136, 271
Sse9I AATT 2 cut(s) 27, 202
SsiI CCGC 3 cut(s) 36, 222, 237
SspMI CTAG 1 cut(s) 277
SstI GAGCTC 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 11
TaiI ACGT 2 cut(s) 131, 163
TaqI TCGA 3 cut(s) 80, 146, 215
TasI AATT 2 cut(s) 27, 202
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
Vha464I CTTAAG 1 cut(s) 136
XapI RAATTY 1 cut(s) 202
XspI CTAG 1 cut(s) 277
ZraI GACGTC 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.