Rorug01G0053200

ATP-dependent serine protease that mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides as well as certain short-lived regulatory proteins in the mitochondrial matrix. May also have a chaperone function in the assembly of inner membrane protein complexes. Participates in the regulation of mitochondrial gene expression and in the maintenance of the integrity of the mitochondrial genome. Binds to mitochondrial DNA in a site-specific manner

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
8764640 .. 8766403
1764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0053200.1

Sequence Viewer

Length: 921 bp
ATGGAGGTGGAGCAAGTCCTTCACATGAATGGCGGATGTGGGAGAACAAGCTATTCAAACAACTCGCTTCTTCAAAGAGCAGTGATTTCATGGGTGAAGCCCATTTTAGATGCAAGCATAGAGAAGCTGTGTAGCTCCAACCTCCCTGCAGAGTGTTTGAGGATTGGTGACTTGGGATGTTCTTCAGGACCAAACACCCTTTTAGTCGTATCAAATGTCATCGACATGATCCAGAATACATGTCAAAAATTGAACCGTCGACCTCCATCGCTCCAAGTATTTTTGAATGATCTTCCCCAAAACGACTTTAACACAGTTTTCAAATCATTGCCAAGCTTCTACAAAAAACTCGAAGAAAGGAAGTGGCTGGAGCCATGCTTCATTGCAGGAATGCCCGGTTCTTTCTATGGCAGGATCTTTCCTAAGAATTCTATCAACTTTTTCCACTCTTCGTACTCTCTGCAATGGATCTCTAAGGTTCCAAAAGGTTTGGTAACAAAAGGAGGACTCAACGAGGGAAACATATGCACAGCCAAGACAAGCCCACCTTCTGTGTTTAATGAATACTTTGGGCAATTTAAAAACGACTTCACAGTGTTTCTAAGGTCTCGTGCAGAAGAGTTGGTCCCTCAGGGTAGAATGGTCCTCACAATCAGGGGGAGCATAAACAGTCATGAACCCCTCTCTATATTAGAATTTCTTGGATTGAAAATCAATGATATGGTTTTAGAGGGTTTGATTGAAAAGAAAAACTTAGACTACTTCAATATTCCATACTATGAACCTACAATGGAGGAACTGATGGAGCTGATCGAGACAGAAGGATCCTTTAGGTTGCAGGACCATCAAGTTTTTAAACATGATTGGGACTCTTTTATAAAGGAAGCTGATAGTGGTCTCAGTAAGAAAGCAAGGGTATGA

Protein Analysis

306

Amino Acids

34.72

Weight (kDa)

6.54

Isoelectric Point (pI)

47.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_7 PF03492 40 - 295 1.8e-100 SAM dependent carboxyl methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 878
AccI GTMKAC 1 cut(s) 259
AciI CCGC 1 cut(s) 33
AclWI GGATC 5 cut(s) 223, 422, 476, 819, 832
AcsI RAATTY 2 cut(s) 427, 695
AcuI CTGAAG 1 cut(s) 168
AfaI GTAC 1 cut(s) 455
AflIII ACRYGT 1 cut(s) 239
AgsI TTSAA 8 cut(s) 57, 74, 253, 286, 322, 709, 743, 766
AluBI AGCT 6 cut(s) 51, 127, 135, 336, 808, 887
AluI AGCT 6 cut(s) 51, 127, 135, 336, 808, 887
Alw26I GTCTC 3 cut(s) 612, 809, 902
AlwI GGATC 5 cut(s) 223, 422, 476, 819, 832
ApoI RAATTY 2 cut(s) 427, 695
AspS9I GGNCC 4 cut(s) 188, 625, 643, 841
AsuC2I CCSGG 1 cut(s) 396
AsuHPI GGTGA 2 cut(s) 106, 179
AvaII GGWCC 4 cut(s) 188, 625, 643, 841
AxyI CCTNAGG 1 cut(s) 630
BamHI GGATCC 1 cut(s) 824
BauI CACGAG 1 cut(s) 609
BccI CCATC 3 cut(s) 274, 796, 852
BcnI CCSGG 1 cut(s) 396
BcoDI GTCTC 3 cut(s) 612, 809, 902
BfmI CTRYAG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 396
Bme18I GGWCC 4 cut(s) 188, 625, 643, 841
BmgT120I GGNCC 4 cut(s) 188, 625, 643, 841
BmiI GGNNCC 4 cut(s) 372, 480, 627, 826
BmrFI CCNGG 1 cut(s) 396
BmsI GCATC 1 cut(s) 100
BpmI CTGGAG 1 cut(s) 389
BpuMI CCSGG 1 cut(s) 396
BsaI GGTCTC 2 cut(s) 612, 902
Bse21I CCTNAGG 1 cut(s) 630
Bse3DI GCAATG 3 cut(s) 326, 381, 470
BseGI GGATG 2 cut(s) 41, 182
BseMI GCAATG 3 cut(s) 326, 381, 470
BseMII CTCAG 2 cut(s) 644, 913
BsgI GTGCAG 1 cut(s) 633
BsiSI CCGG 1 cut(s) 396
BslFI GGGAC 2 cut(s) 611, 881
BsmAI GTCTC 3 cut(s) 612, 809, 902
BsmFI GGGAC 2 cut(s) 611, 881
BsmI GAATGC 1 cut(s) 396
Bso31I GGTCTC 2 cut(s) 612, 902
Bsp143I GATC 6 cut(s) 228, 289, 414, 468, 810, 824
BspACI CCGC 1 cut(s) 33
BspCNI CTCAG 2 cut(s) 643, 912
BspHI TCATGA 1 cut(s) 673
BspLI GGNNCC 4 cut(s) 372, 480, 627, 826
BspMAI CTGCAG 1 cut(s) 151
BspPI GGATC 5 cut(s) 223, 422, 476, 819, 832
BspTNI GGTCTC 2 cut(s) 612, 902
BsrDI GCAATG 3 cut(s) 326, 381, 470
BssMI GATC 6 cut(s) 228, 289, 414, 468, 810, 824
BssSI CACGAG 1 cut(s) 609
Bst2BI CACGAG 1 cut(s) 609
Bst4CI ACNGT 4 cut(s) 257, 316, 595, 671
Bst6I CTCTTC 2 cut(s) 454, 612
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 6 cut(s) 423, 474, 602, 630, 754, 899
BstF5I GGATG 2 cut(s) 41, 182
BstKTI GATC 6 cut(s) 231, 292, 417, 471, 813, 827
BstMAI GTCTC 3 cut(s) 612, 809, 902
BstMBI GATC 6 cut(s) 228, 289, 414, 468, 810, 824
BstNSI RCATGY 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 394
BstSFI CTRYAG 1 cut(s) 147
BstX2I RGATCY 3 cut(s) 414, 468, 824
BstYI RGATCY 3 cut(s) 414, 468, 824
Bsu36I CCTNAGG 1 cut(s) 630
BtgZI GCGATG 1 cut(s) 252
BtsCI GGATG 2 cut(s) 41, 182
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 2 cut(s) 87, 600
Cac8I GCNNGC 1 cut(s) 115
CciI TCATGA 1 cut(s) 673
Cfr13I GGNCC 4 cut(s) 188, 625, 643, 841
Csp6I GTAC 1 cut(s) 454
CviAII CATG 7 cut(s) 25, 90, 226, 240, 375, 674, 860
CviQI GTAC 1 cut(s) 454
DdeI CTNAG 6 cut(s) 423, 474, 602, 630, 754, 899
DpnI GATC 6 cut(s) 230, 291, 416, 470, 812, 826
DpnII GATC 6 cut(s) 228, 289, 414, 468, 810, 824
DraI TTTAAA 2 cut(s) 580, 856
Eam1104I CTCTTC 2 cut(s) 454, 612
EarI CTCTTC 2 cut(s) 454, 612
EciI GGCGGA 1 cut(s) 48
Eco31I GGTCTC 2 cut(s) 612, 902
Eco47I GGWCC 4 cut(s) 188, 625, 643, 841
Eco57I CTGAAG 1 cut(s) 168
Eco81I CCTNAGG 1 cut(s) 630
EcoRI GAATTC 1 cut(s) 427
FaeI CATG 7 cut(s) 28, 93, 229, 243, 378, 677, 863
FalI AAGNNNNNCTT 4 cut(s) 532, 564, 737, 769
FaqI GGGAC 2 cut(s) 611, 881
FatI CATG 7 cut(s) 24, 89, 225, 239, 374, 673, 859
FauNDI CATATG 1 cut(s) 524
FblI GTMKAC 1 cut(s) 259
FokI GGATG 2 cut(s) 48, 189
GsuI CTGGAG 1 cut(s) 389
HapII CCGG 1 cut(s) 396
Hin1II CATG 7 cut(s) 28, 93, 229, 243, 378, 677, 863
HincII GTYRAC 1 cut(s) 260
HindII GTYRAC 1 cut(s) 260
HindIII AAGCTT 1 cut(s) 334
HinfI GANTC 2 cut(s) 507, 869
HpaII CCGG 1 cut(s) 396
HphI GGTGA 2 cut(s) 106, 179
Hpy166II GTNNAC 1 cut(s) 260
Hpy188III TCNNGA 4 cut(s) 186, 232, 674, 814
Hpy8I GTNNAC 1 cut(s) 260
Hpy99I CGWCG 1 cut(s) 261
HpyAV CCTTC 3 cut(s) 29, 558, 815
HpyCH4III ACNGT 4 cut(s) 257, 316, 595, 671
HpyCH4V TGCA 7 cut(s) 113, 149, 386, 463, 528, 614, 838
HpyF3I CTNAG 6 cut(s) 423, 474, 602, 630, 754, 899
Hsp92II CATG 7 cut(s) 28, 93, 229, 243, 378, 677, 863
Kzo9I GATC 6 cut(s) 228, 289, 414, 468, 810, 824
LmnI GCTCC 6 cut(s) 10, 140, 276, 370, 660, 805
LweI GCATC 1 cut(s) 100
MaeIII GTNAC 2 cut(s) 167, 493
MalI GATC 6 cut(s) 230, 291, 416, 470, 812, 826
MboI GATC 6 cut(s) 228, 289, 414, 468, 810, 824
MboII GAAGA 6 cut(s) 62, 174, 284, 365, 441, 629
MflI RGATCY 3 cut(s) 414, 468, 824
MluCI AATT 4 cut(s) 248, 427, 575, 695
MlyI GAGTC 2 cut(s) 501, 863
MmeI TCCRAC 1 cut(s) 162
MseI TTAA 4 cut(s) 309, 558, 579, 855
MslI CAYNNNNRTG 2 cut(s) 27, 224
MspI CCGG 1 cut(s) 396
MspR9I CCNGG 1 cut(s) 396
Mva1269I GAATGC 1 cut(s) 396
NciI CCSGG 1 cut(s) 396
NdeI CATATG 1 cut(s) 524
NdeII GATC 6 cut(s) 228, 289, 414, 468, 810, 824
NlaIII CATG 7 cut(s) 28, 93, 229, 243, 378, 677, 863
NlaIV GGNNCC 4 cut(s) 372, 480, 627, 826
NmuCI GTSAC 1 cut(s) 167
NspI RCATGY 1 cut(s) 243
PagI TCATGA 1 cut(s) 673
PciI ACATGT 1 cut(s) 239
PctI GAATGC 1 cut(s) 396
PleI GAGTC 2 cut(s) 501, 863
PpsI GAGTC 2 cut(s) 501, 863
PscI ACATGT 1 cut(s) 239
PsiI TTATAA 1 cut(s) 878
PspN4I GGNNCC 4 cut(s) 372, 480, 627, 826
PspPI GGNCC 4 cut(s) 188, 625, 643, 841
PstI CTGCAG 1 cut(s) 151
PsuI RGATCY 3 cut(s) 414, 468, 824
RsaI GTAC 1 cut(s) 455
RsaNI GTAC 1 cut(s) 454
RseI CAYNNNNRTG 2 cut(s) 27, 224
SalI GTCGAC 1 cut(s) 258
SaqAI TTAA 4 cut(s) 309, 558, 579, 855
Sau3AI GATC 6 cut(s) 228, 289, 414, 468, 810, 824
Sau96I GGNCC 4 cut(s) 188, 625, 643, 841
SchI GAGTC 2 cut(s) 501, 863
ScrFI CCNGG 1 cut(s) 396
SfaNI GCATC 1 cut(s) 100
SfcI CTRYAG 1 cut(s) 147
SinI GGWCC 4 cut(s) 188, 625, 643, 841
SmiMI CAYNNNNRTG 2 cut(s) 27, 224
Sse9I AATT 4 cut(s) 248, 427, 575, 695
SsiI CCGC 1 cut(s) 33
SspI AATATT 1 cut(s) 769
StyD4I CCNGG 1 cut(s) 394
TaaI ACNGT 4 cut(s) 257, 316, 595, 671
TaqI TCGA 4 cut(s) 222, 259, 351, 813
TasI AATT 4 cut(s) 248, 427, 575, 695
Tru1I TTAA 4 cut(s) 309, 558, 579, 855
Tru9I TTAA 4 cut(s) 309, 558, 579, 855
TscAI CASTG 2 cut(s) 87, 600
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 6 cut(s) 41, 78, 370, 576, 690, 795
TspRI CASTG 2 cut(s) 87, 600
VpaK11BI GGWCC 4 cut(s) 188, 625, 643, 841
XapI RAATTY 2 cut(s) 427, 695
XceI RCATGY 1 cut(s) 243
XmiI GTMKAC 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.