Rorug01G0468800

VIN3-like protein 1 isoform

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
56113956 .. 56114392
437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0468800.1

Sequence Viewer

Length: 228 bp
ATGATGTATGGAGTGCCTAATGTGAAGGCTGACAAAGTTGATATAGTTCAACGGCGAGTTAACCTTATGGCCGGGGAAGGTGTCAACATTGTGGTCAGTGCTATGGCTAGAAATGATCCTTCCTACTCGTTTGATCACAGGAGAACAATGCGATTGGAACAACTGACGCTAGGGTTTTTCTGTGGTGCTGGACCATCTGACCCAAGACTAGCTTATGATGCATCCTGA

Protein Analysis

75

Amino Acids

8.31

Weight (kDa)

7.92

Isoelectric Point (pI)

40.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AcoI YGGCCR 1 cut(s) 69
AgsI TTSAA 1 cut(s) 50
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
AlwI GGATC 1 cut(s) 110
AoxI GGCC 1 cut(s) 69
AspS9I GGNCC 1 cut(s) 191
AsuC2I CCSGG 1 cut(s) 73
AvaII GGWCC 1 cut(s) 191
BccI CCATC 1 cut(s) 202
BceAI ACGGC 1 cut(s) 68
BclI TGATCA 1 cut(s) 133
BcnI CCSGG 1 cut(s) 73
BfaI CTAG 3 cut(s) 108, 170, 209
Bme1390I CCNGG 1 cut(s) 73
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmrFI CCNGG 1 cut(s) 73
BmsI GCATC 1 cut(s) 208
BpuMI CCSGG 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 72
BseGI GGATG 1 cut(s) 221
BshFI GGCC 1 cut(s) 71
BsiSI CCGG 1 cut(s) 72
BsnI GGCC 1 cut(s) 71
Bsp143I GATC 2 cut(s) 115, 133
BspANI GGCC 1 cut(s) 71
BspPI GGATC 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 2 cut(s) 115, 133
BstF5I GGATG 1 cut(s) 221
BstKTI GATC 2 cut(s) 118, 136
BstMBI GATC 2 cut(s) 115, 133
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstSCI CCNGG 1 cut(s) 71
BsuRI GGCC 1 cut(s) 71
BtsCI GGATG 1 cut(s) 221
BtsIMutI CAGTG 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 191
CseI GACGC 1 cut(s) 175
CviJI RGCY 4 cut(s) 29, 71, 107, 212
CviKI_1 RGCY 4 cut(s) 29, 71, 107, 212
DpnI GATC 2 cut(s) 117, 135
DpnII GATC 2 cut(s) 115, 133
EaeI YGGCCR 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 191
EcoT22I ATGCAT 1 cut(s) 223
FaiI YATR 5 cut(s) 9, 44, 68, 104, 216
FalI AAGNNNNNCTT 2 cut(s) 196, 228
FbaI TGATCA 1 cut(s) 133
FokI GGATG 1 cut(s) 208
FspBI CTAG 3 cut(s) 108, 170, 209
HaeIII GGCC 1 cut(s) 71
HapII CCGG 1 cut(s) 72
HgaI GACGC 1 cut(s) 175
HincII GTYRAC 2 cut(s) 61, 85
HindII GTYRAC 2 cut(s) 61, 85
HpaI GTTAAC 1 cut(s) 61
HpaII CCGG 1 cut(s) 72
Hpy166II GTNNAC 2 cut(s) 61, 85
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 225
Hpy8I GTNNAC 2 cut(s) 61, 85
HpyAV CCTTC 3 cut(s) 19, 71, 129
HpyCH4V TGCA 1 cut(s) 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
Ksp22I TGATCA 1 cut(s) 133
KspAI GTTAAC 1 cut(s) 61
Kzo9I GATC 2 cut(s) 115, 133
LpnPI CCDG 3 cut(s) 85, 124, 174
LweI GCATC 1 cut(s) 208
MaeI CTAG 3 cut(s) 108, 170, 209
MalI GATC 2 cut(s) 117, 135
MboI GATC 2 cut(s) 115, 133
Mph1103I ATGCAT 1 cut(s) 223
MseI TTAA 1 cut(s) 60
MspI CCGG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 73
MwoI GCNNNNNNNGC 1 cut(s) 218
NciI CCSGG 1 cut(s) 73
NdeII GATC 2 cut(s) 115, 133
NsiI ATGCAT 1 cut(s) 223
PspPI GGNCC 1 cut(s) 191
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 2 cut(s) 115, 133
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 73
SetI ASST 3 cut(s) 66, 82, 214
SfaNI GCATC 1 cut(s) 208
SinI GGWCC 1 cut(s) 191
SspMI CTAG 3 cut(s) 108, 170, 209
StyD4I CCNGG 1 cut(s) 71
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TscAI CASTG 1 cut(s) 103
TspRI CASTG 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 191
XspI CTAG 3 cut(s) 108, 170, 209
Zsp2I ATGCAT 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.