Rorug02G0272700

Nonspecific lipid-transfer protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
29135349 .. 29135891
543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0272700.1

Sequence Viewer

Length: 282 bp
ATGAAATTGGAATCAGTTCTGAAATTGAACAGAGGTTTTATTCAACTAAAAATCTGCAGTTTTACTTTTATGTCGCATCAAGAACAGATTGCTGCACAATCAGGGGAGATGCTAGGTGCAATTGAACGCTTTGAAATGGAGTACAAAAGCATTAAAAAAGGTTGGGACTTGGGAGTGAAAGAATTATGGGATCAAATGGTTAAGATGCGAACTGAGACAACCCTTCCTGATGGGACTCGAACTATGAATGATGATGAAAATGTGCAAAGGTTCTTGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.91

Weight (kDa)

5.45

Isoelectric Point (pI)

30.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 198
AfaI GTAC 1 cut(s) 143
AgsI TTSAA 4 cut(s) 28, 44, 125, 134
Alw26I GTCTC 1 cut(s) 209
AlwI GGATC 1 cut(s) 198
ApeKI GCWGC 1 cut(s) 92
Asp700I GAANNNNTTC 1 cut(s) 15
BbvI GCAGC 1 cut(s) 79
BccI CCATC 1 cut(s) 224
BcoDI GTCTC 1 cut(s) 209
BfaI CTAG 1 cut(s) 113
BfmI CTRYAG 1 cut(s) 55
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
BmsI GCATC 3 cut(s) 85, 99, 195
BseMII CTCAG 1 cut(s) 204
BseXI GCAGC 1 cut(s) 79
BsgI GTGCAG 1 cut(s) 78
BslFI GGGAC 2 cut(s) 179, 247
BsmAI GTCTC 1 cut(s) 209
BsmFI GGGAC 2 cut(s) 179, 247
Bsp143I GATC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 205
BspMAI CTGCAG 1 cut(s) 59
BspPI GGATC 1 cut(s) 198
BssMI GATC 1 cut(s) 190
BstDEI CTNAG 1 cut(s) 213
BstKTI GATC 1 cut(s) 193
BstMAI GTCTC 1 cut(s) 209
BstMBI GATC 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 55
BstV1I GCAGC 1 cut(s) 79
Csp6I GTAC 1 cut(s) 142
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 1 cut(s) 213
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
FaiI YATR 3 cut(s) 71, 187, 245
FaqI GGGAC 2 cut(s) 179, 247
Fnu4HI GCNGC 1 cut(s) 93
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 113
GluI GCNGC 1 cut(s) 93
HinfI GANTC 2 cut(s) 11, 235
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 2 cut(s) 80, 227
HpyAV CCTTC 1 cut(s) 233
HpyCH4V TGCA 4 cut(s) 57, 95, 119, 265
HpyF3I CTNAG 1 cut(s) 213
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 2 cut(s) 87, 240
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 3 cut(s) 85, 99, 195
MaeI CTAG 1 cut(s) 113
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MfeI CAATTG 1 cut(s) 120
MluCI AATT 4 cut(s) 5, 23, 120, 182
MlyI GAGTC 1 cut(s) 229
MnlI CCTC 1 cut(s) 26
MroXI GAANNNNTTC 1 cut(s) 15
MseI TTAA 2 cut(s) 153, 201
MunI CAATTG 1 cut(s) 120
NdeII GATC 1 cut(s) 190
PdmI GAANNNNTTC 1 cut(s) 15
PfeI GAWTC 1 cut(s) 11
PkrI GCNGC 1 cut(s) 94
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
PstI CTGCAG 1 cut(s) 59
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 153, 201
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 1 cut(s) 190
SchI GAGTC 1 cut(s) 229
SetI ASST 4 cut(s) 37, 118, 163, 272
SfaNI GCATC 3 cut(s) 85, 99, 195
SfcI CTRYAG 1 cut(s) 55
SgeI CNNG 6 cut(s) 92, 114, 125, 181, 239, 249
Sse9I AATT 4 cut(s) 5, 23, 120, 182
SspMI CTAG 1 cut(s) 113
TaqI TCGA 1 cut(s) 238
TasI AATT 4 cut(s) 5, 23, 120, 182
TatI WGTACW 1 cut(s) 141
TfiI GAWTC 1 cut(s) 11
Tru1I TTAA 2 cut(s) 153, 201
Tru9I TTAA 2 cut(s) 153, 201
TseI GCWGC 1 cut(s) 92
TspDTI ATGAA 3 cut(s) 17, 260, 270
XmnI GAANNNNTTC 1 cut(s) 15
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.