Rorug03G0148000

UPF0554 protein C2orf43 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0002532
Physical Location & Seq
Forward (+)
12141880 .. 12143290
1411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0148000.1

Sequence Viewer

Length: 324 bp
ATGGGCGATTCTTCATCTGCTTCATACATCCACATGGTGCATCACTTGATCGAGGAGTGCATCATCTTCAACATGAGCAGAGAAGAGTGCATGGAAGCCCTCTCCAAGCATGCTAATATAAAACCCATTATCACCTCCACAGTTTGGAAGGAGCTGGAGAAGGAGAACAAGGAGTTCTTTGAGGCCTACACAAACAGCAGAGAAGCTGTGAGAGAATCCAAAATGGAGAGAAAGCAAAGAATCCAGAAGATGCTTTCGGGTCATCTTTCTCAAACAGACACAGACGACAGCAGCTGCACCAATACTACCGAATCCGACGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LIDHydrolase

Protein Analysis

107

Amino Acids

12.38

Weight (kDa)

5.19

Isoelectric Point (pI)

69.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 13 - 64 1e-26 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 144
AdeI CACNNNGTG 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 1 cut(s) 70
AluBI AGCT 3 cut(s) 154, 206, 294
AluI AGCT 3 cut(s) 154, 206, 294
AlwNI CAGNNNCTG 1 cut(s) 294
AoxI GGCC 1 cut(s) 183
ApeKI GCWGC 2 cut(s) 291, 294
AsuHPI GGTGA 1 cut(s) 124
BbvI GCAGC 2 cut(s) 281, 303
BfaI CTAG 1 cut(s) 322
BisI GCNGC 2 cut(s) 292, 295
BlsI GCNGC 2 cut(s) 293, 296
BmsI GCATC 3 cut(s) 49, 69, 240
BpmI CTGGAG 1 cut(s) 176
Bsc4I CCNNNNNNNGG 1 cut(s) 144
BseGI GGATG 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 68
BseXI GCAGC 2 cut(s) 281, 303
BsgI GTGCAG 1 cut(s) 280
BshFI GGCC 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 144
BsnI GGCC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 48
BspANI GGCC 1 cut(s) 185
BssMI GATC 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 111
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 113
BstV1I GCAGC 2 cut(s) 281, 303
BsuRI GGCC 1 cut(s) 185
BtsCI GGATG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 111
CaiI CAGNNNCTG 1 cut(s) 294
CviAII CATG 4 cut(s) 34, 73, 91, 110
CviJI RGCY 5 cut(s) 98, 154, 185, 206, 294
CviKI_1 RGCY 5 cut(s) 98, 154, 185, 206, 294
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
DraIII CACNNNGTG 1 cut(s) 37
Eam1104I CTCTTC 1 cut(s) 78
EarI CTCTTC 1 cut(s) 78
Eco147I AGGCCT 1 cut(s) 185
FaeI CATG 4 cut(s) 37, 76, 94, 113
FaiI YATR 6 cut(s) 25, 35, 74, 92, 111, 119
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FatI CATG 4 cut(s) 33, 72, 90, 109
Fnu4HI GCNGC 2 cut(s) 292, 295
FokI GGATG 1 cut(s) 14
Fsp4HI GCNGC 2 cut(s) 292, 295
FspBI CTAG 1 cut(s) 322
GluI GCNGC 2 cut(s) 292, 295
GsuI CTGGAG 1 cut(s) 176
HaeIII GGCC 1 cut(s) 185
Hin1II CATG 4 cut(s) 37, 76, 94, 113
HinfI GANTC 4 cut(s) 8, 215, 240, 311
HphI GGTGA 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 316
Hpy188III TCNNGA 1 cut(s) 244
Hpy99I CGWCG 1 cut(s) 320
HpyAV CCTTC 2 cut(s) 142, 154
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4V TGCA 4 cut(s) 40, 60, 90, 297
Hsp92II CATG 4 cut(s) 37, 76, 94, 113
Kzo9I GATC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 140, 257
Lsp1109I GCAGC 2 cut(s) 281, 303
LweI GCATC 3 cut(s) 49, 69, 240
MaeI CTAG 1 cut(s) 322
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 4 cut(s) 3, 58, 95, 259
MnlI CCTC 4 cut(s) 46, 110, 145, 175
MslI CAYNNNNRTG 1 cut(s) 32
MspA1I CMGCKG 1 cut(s) 294
NdeII GATC 1 cut(s) 48
NlaIII CATG 4 cut(s) 37, 76, 94, 113
NspI RCATGY 1 cut(s) 113
PaeI GCATGC 1 cut(s) 113
PceI AGGCCT 1 cut(s) 185
PfeI GAWTC 4 cut(s) 8, 215, 240, 311
PflMI CCANNNNNTGG 1 cut(s) 144
PkrI GCNGC 2 cut(s) 293, 296
PstNI CAGNNNCTG 1 cut(s) 294
PvuII CAGCTG 1 cut(s) 294
RseI CAYNNNNRTG 1 cut(s) 32
SatI GCNGC 2 cut(s) 292, 295
Sau3AI GATC 1 cut(s) 48
SetI ASST 4 cut(s) 137, 156, 208, 296
SfaNI GCATC 3 cut(s) 49, 69, 240
SmiMI CAYNNNNRTG 1 cut(s) 32
SphI GCATGC 1 cut(s) 113
SseBI AGGCCT 1 cut(s) 185
SspMI CTAG 1 cut(s) 322
StuI AGGCCT 1 cut(s) 185
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 1 cut(s) 51
TfiI GAWTC 4 cut(s) 8, 215, 240, 311
TseI GCWGC 2 cut(s) 291, 294
TspDTI ATGAA 1 cut(s) 12
Van91I CCANNNNNTGG 1 cut(s) 144
XceI RCATGY 1 cut(s) 113
XspI CTAG 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.