Rorug03G0202700

Mitochondrial

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
17903809 .. 17903979
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0202700.1

Sequence Viewer

Length: 171 bp
ATGACTTTCCATGTATCACACATCCTTAGGGAAGGGAACAAAGTAGCAGACAAGCTGGCTAATAATGGTGCTTTGCATGATGGAGCGGTATGGTGGATTGCCCTCCCGTCCATTATTACTTCTGAGTTTGGTCATGATTACTCTTCGCGTACTAGTTATCGGTTTTCTTAG

Protein Analysis

56

Amino Acids

6.3

Weight (kDa)

6.9

Isoelectric Point (pI)

31.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 86
AccII CGCG 1 cut(s) 148
AciI CCGC 1 cut(s) 86
AfaI GTAC 1 cut(s) 151
AhlI ACTAGT 1 cut(s) 152
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AxyI CCTNAGG 1 cut(s) 26
BccI CCATC 1 cut(s) 74
BcuI ACTAGT 1 cut(s) 152
BfaI CTAG 1 cut(s) 153
Bse21I CCTNAGG 1 cut(s) 26
BseGI GGATG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 114
Bsh1236I CGCG 1 cut(s) 148
BspACI CCGC 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 115
BspFNI CGCG 1 cut(s) 148
BspHI TCATGA 1 cut(s) 133
BsrBI CCGCTC 1 cut(s) 86
Bst6I CTCTTC 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 3 cut(s) 26, 123, 168
BstF5I GGATG 1 cut(s) 21
BstFNI CGCG 1 cut(s) 148
BstUI CGCG 1 cut(s) 148
Bsu36I CCTNAGG 1 cut(s) 26
BtsCI GGATG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 57
CciI TCATGA 1 cut(s) 133
Csp6I GTAC 1 cut(s) 150
CviAII CATG 3 cut(s) 11, 77, 134
CviJI RGCY 2 cut(s) 55, 59
CviKI_1 RGCY 2 cut(s) 55, 59
CviQI GTAC 1 cut(s) 150
DdeI CTNAG 3 cut(s) 26, 123, 168
Eam1104I CTCTTC 1 cut(s) 148
EarI CTCTTC 1 cut(s) 148
Eco81I CCTNAGG 1 cut(s) 26
FaeI CATG 3 cut(s) 14, 80, 137
FaiI YATR 4 cut(s) 12, 78, 91, 135
FatI CATG 3 cut(s) 10, 76, 133
FokI GGATG 1 cut(s) 8
FspBI CTAG 1 cut(s) 153
Hin1II CATG 3 cut(s) 14, 80, 137
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 76
HpyF3I CTNAG 3 cut(s) 26, 123, 168
Hsp92II CATG 3 cut(s) 14, 80, 137
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 1 cut(s) 41
MaeI CTAG 1 cut(s) 153
MbiI CCGCTC 1 cut(s) 86
MboII GAAGA 1 cut(s) 135
MnlI CCTC 1 cut(s) 113
MvnI CGCG 1 cut(s) 148
NlaIII CATG 3 cut(s) 14, 80, 137
PagI TCATGA 1 cut(s) 133
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SetI ASST 1 cut(s) 57
SgeI CNNG 8 cut(s) 23, 64, 68, 89, 118, 146, 159, 165
SpeI ACTAGT 1 cut(s) 152
SsiI CCGC 1 cut(s) 86
SspMI CTAG 1 cut(s) 153
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.