Rorug04G0053100

FLX-like 4

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0002508
Physical Location & Seq
Forward (+)
8259637 .. 8260050
414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0053100.1

Sequence Viewer

Length: 414 bp
ATGAATCAGATATTGATACTATTGTTCATCCTCTTGCTCACTAAGACTGAGGCTGCTTGGAATTCCAGACATGTTGAAATTATCAATGATTTGGGTCCAAAAGCAGATCTTACCATTCATTGCAAGTCTAAGGATGACGATCTGGGAGTCCATTTGCTTCGCTTTCAAGAGTCCTTTTGGATCAATTTCAAACTGAACTTTCTTGGAGGTACACTATTTTTTTGCAGCTTCCAATGGCCTGGCAATTTTCATCACCTTGATGTTTACAGTCAAGAGAGAGACAATGTGGCCCCTAAAAAATGTAGGACATGCAGTTACAAGATCAGATCTGATGGTGGACATAGGTTCAATCAGGAATTCCAAGATTTCACTGATTTTTTCCCGTGGAATAAAGAGCGAATTCAGTTGACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

16.23

Weight (kDa)

7.0

Isoelectric Point (pI)

31.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 24 - 129 7.2e-27 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 188
AcsI RAATTY 3 cut(s) 61, 356, 399
AfaI GTAC 1 cut(s) 211
AflIII ACRYGT 1 cut(s) 70
AgsI TTSAA 4 cut(s) 77, 167, 190, 349
AjnI CCWGG 1 cut(s) 238
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
Alw26I GTCTC 1 cut(s) 273
AlwI GGATC 1 cut(s) 188
AoxI GGCC 2 cut(s) 236, 288
ApeKI GCWGC 2 cut(s) 53, 225
ApoI RAATTY 3 cut(s) 61, 356, 399
AspS9I GGNCC 2 cut(s) 95, 289
AsuHPI GGTGA 1 cut(s) 245
AvaII GGWCC 1 cut(s) 95
BaeI ACNNNNGTAYC 2 cut(s) 8, 41
BbvI GCAGC 2 cut(s) 40, 237
BccI CCATC 1 cut(s) 326
BciT130I CCWGG 1 cut(s) 240
BcoDI GTCTC 1 cut(s) 273
BglII AGATCT 2 cut(s) 106, 326
BisI GCNGC 2 cut(s) 54, 226
BlsI GCNGC 2 cut(s) 55, 227
Bme1390I CCNGG 1 cut(s) 240
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 2 cut(s) 95, 289
BmiI GGNNCC 2 cut(s) 96, 291
BmrFI CCNGG 1 cut(s) 240
BsaBI GATNNNNATC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 383
Bse3DI GCAATG 1 cut(s) 118
Bse8I GATNNNNATC 1 cut(s) 138
BseBI CCWGG 1 cut(s) 240
BseDI CCNNGG 1 cut(s) 383
BseGI GGATG 2 cut(s) 27, 139
BseJI GATNNNNATC 1 cut(s) 138
BseMI GCAATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 39
BseXI GCAGC 2 cut(s) 40, 237
BshFI GGCC 2 cut(s) 238, 290
BsmAI GTCTC 1 cut(s) 273
BsnI GGCC 2 cut(s) 238, 290
Bsp143I GATC 5 cut(s) 106, 139, 180, 321, 326
BspANI GGCC 2 cut(s) 238, 290
BspCNI CTCAG 1 cut(s) 40
BspLI GGNNCC 2 cut(s) 96, 291
BspPI GGATC 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 383
BssMI GATC 5 cut(s) 106, 139, 180, 321, 326
Bst2UI CCWGG 1 cut(s) 240
Bst4CI ACNGT 1 cut(s) 269
BstDEI CTNAG 3 cut(s) 42, 48, 129
BstDSI CCRYGG 1 cut(s) 383
BstF5I GGATG 2 cut(s) 27, 139
BstKTI GATC 5 cut(s) 109, 142, 183, 324, 329
BstMAI GTCTC 1 cut(s) 273
BstMBI GATC 5 cut(s) 106, 139, 180, 321, 326
BstNI CCWGG 1 cut(s) 240
BstNSI RCATGY 2 cut(s) 74, 312
BstSCI CCNGG 1 cut(s) 238
BstV1I GCAGC 2 cut(s) 40, 237
BstX2I RGATCY 2 cut(s) 106, 326
BstXI CCANNNNNNTGG 1 cut(s) 239
BstYI RGATCY 2 cut(s) 106, 326
BsuRI GGCC 2 cut(s) 238, 290
BtgI CCRYGG 1 cut(s) 383
BtsCI GGATG 2 cut(s) 27, 139
BtsIMutI CAGTG 1 cut(s) 369
Cfr13I GGNCC 2 cut(s) 95, 289
Csp6I GTAC 1 cut(s) 210
CviAII CATG 2 cut(s) 71, 309
CviJI RGCY 4 cut(s) 53, 228, 238, 290
CviKI_1 RGCY 4 cut(s) 53, 228, 238, 290
CviQI GTAC 1 cut(s) 210
DdeI CTNAG 3 cut(s) 42, 48, 129
DpnI GATC 5 cut(s) 108, 141, 182, 323, 328
DpnII GATC 5 cut(s) 106, 139, 180, 321, 326
Eco47I GGWCC 1 cut(s) 95
EcoRI GAATTC 3 cut(s) 61, 356, 399
EcoRII CCWGG 1 cut(s) 238
FaeI CATG 2 cut(s) 74, 312
FaiI YATR 4 cut(s) 72, 310, 342, 412
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FatI CATG 2 cut(s) 70, 308
Fnu4HI GCNGC 2 cut(s) 54, 226
FokI GGATG 2 cut(s) 14, 146
Fsp4HI GCNGC 2 cut(s) 54, 226
GluI GCNGC 2 cut(s) 54, 226
HaeIII GGCC 2 cut(s) 238, 290
Hin1II CATG 2 cut(s) 74, 312
HincII GTYRAC 1 cut(s) 408
HindII GTYRAC 1 cut(s) 408
HinfI GANTC 3 cut(s) 4, 147, 170
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 4 cut(s) 212, 265, 338, 408
Hpy188I TCNGA 3 cut(s) 9, 326, 331
Hpy188III TCNNGA 4 cut(s) 66, 167, 272, 353
Hpy8I GTNNAC 4 cut(s) 212, 265, 338, 408
HpyCH4III ACNGT 1 cut(s) 269
HpyCH4V TGCA 3 cut(s) 123, 225, 312
HpyF3I CTNAG 3 cut(s) 42, 48, 129
Hsp92II CATG 2 cut(s) 74, 312
Kzo9I GATC 5 cut(s) 106, 139, 180, 321, 326
LpnPI CCDG 5 cut(s) 79, 128, 225, 252, 338
Lsp1109I GCAGC 2 cut(s) 40, 237
MaeIII GTNAC 1 cut(s) 314
MalI GATC 5 cut(s) 108, 141, 182, 323, 328
MboI GATC 5 cut(s) 106, 139, 180, 321, 326
MflI RGATCY 2 cut(s) 106, 326
MluCI AATT 6 cut(s) 61, 78, 184, 244, 356, 399
MlyI GAGTC 2 cut(s) 156, 179
MnlI CCTC 3 cut(s) 41, 43, 200
MslI CAYNNNNRTG 1 cut(s) 258
MspR9I CCNGG 1 cut(s) 240
MvaI CCWGG 1 cut(s) 240
NdeII GATC 5 cut(s) 106, 139, 180, 321, 326
NlaIII CATG 2 cut(s) 74, 312
NlaIV GGNNCC 2 cut(s) 96, 291
NspI RCATGY 2 cut(s) 74, 312
PciI ACATGT 1 cut(s) 70
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 55, 227
PleI GAGTC 2 cut(s) 155, 178
PpsI GAGTC 2 cut(s) 155, 178
PscI ACATGT 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
PspN4I GGNNCC 2 cut(s) 96, 291
PspPI GGNCC 2 cut(s) 95, 289
PsuI RGATCY 2 cut(s) 106, 326
RsaI GTAC 1 cut(s) 211
RsaNI GTAC 1 cut(s) 210
RseI CAYNNNNRTG 1 cut(s) 258
SatI GCNGC 2 cut(s) 54, 226
Sau3AI GATC 5 cut(s) 106, 139, 180, 321, 326
Sau96I GGNCC 2 cut(s) 95, 289
SchI GAGTC 2 cut(s) 156, 179
ScrFI CCNGG 1 cut(s) 240
SetI ASST 4 cut(s) 211, 230, 258, 347
SinI GGWCC 1 cut(s) 95
SmiMI CAYNNNNRTG 1 cut(s) 258
Sse9I AATT 6 cut(s) 61, 78, 184, 244, 356, 399
StyD4I CCNGG 1 cut(s) 238
TaaI ACNGT 1 cut(s) 269
TasI AATT 6 cut(s) 61, 78, 184, 244, 356, 399
TfiI GAWTC 1 cut(s) 4
TscAI CASTG 1 cut(s) 376
TseI GCWGC 2 cut(s) 53, 225
TspDTI ATGAA 4 cut(s) 16, 17, 107, 239
TspRI CASTG 1 cut(s) 376
VpaK11BI GGWCC 1 cut(s) 95
XapI RAATTY 3 cut(s) 61, 356, 399
XceI RCATGY 2 cut(s) 74, 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.