Rorug04G0053200

FLX-like 4

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
8270299 .. 8270793
495 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0053200.1

Sequence Viewer

Length: 495 bp
ATGAGGCAGTGCATGACTTTCTTGTATAAATTGATCGACAACTACCCTCTAGTATGCACAATATCATCCTTGCGAAACAAAACACAAAAGAACAAGATGAATCAGATATTGATAGTATTGTTCATCCTCTTGCTCACTAAGACTGAGGCTGCTTGGAATTCCAGACATGTTGAAATTATCAATGATTTGGATCCAAATACATGTCTTACCATTCATTGCAAGTCTAAGGATGATGATCTGGGAGTCCATCTGCTTCACTTTCAAGAGTCCTATTGGATCAATTTCAAAATAAACATTTTCGGAGGTACACTATTCTTTTGCAGCTTCCAGTGGCCCGACAATTTTCATCACCTTGATGTTTACAATCAAGAGAGAGACAATGTACCCCCTAAAGAATGTAGGACATGCAGATACATGATCAGATCTGATGGTGGACATAGGTACAATGAGGAATTCCAAGATTTCACTGATTTTTTCAAGTGGAACGAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

164

Amino Acids

19.73

Weight (kDa)

6.64

Isoelectric Point (pI)

43.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 56 - 161 1.8e-25 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 185, 198, 284
AcsI RAATTY 2 cut(s) 157, 452
AfaI GTAC 3 cut(s) 307, 384, 443
AflIII ACRYGT 2 cut(s) 166, 200
AgsI TTSAA 4 cut(s) 173, 263, 286, 478
AluBI AGCT 1 cut(s) 324
AluI AGCT 1 cut(s) 324
Alw26I GTCTC 1 cut(s) 369
AlwI GGATC 3 cut(s) 185, 198, 284
AoxI GGCC 1 cut(s) 332
ApeKI GCWGC 2 cut(s) 149, 321
ApoI RAATTY 2 cut(s) 157, 452
AspS9I GGNCC 1 cut(s) 333
AsuHPI GGTGA 1 cut(s) 341
BamHI GGATCC 1 cut(s) 190
BbvI GCAGC 2 cut(s) 136, 333
BccI CCATC 2 cut(s) 255, 422
BclI TGATCA 1 cut(s) 417
BcoDI GTCTC 1 cut(s) 369
BfaI CTAG 1 cut(s) 50
BglII AGATCT 1 cut(s) 422
BisI GCNGC 2 cut(s) 150, 322
BlsI GCNGC 2 cut(s) 151, 323
BmgT120I GGNCC 1 cut(s) 333
BmiI GGNNCC 1 cut(s) 192
BsaBI GATNNNNATC 2 cut(s) 189, 234
Bse1I ACTGG 1 cut(s) 328
Bse3DI GCAATG 1 cut(s) 214
Bse8I GATNNNNATC 2 cut(s) 189, 234
BseGI GGATG 3 cut(s) 65, 123, 235
BseJI GATNNNNATC 2 cut(s) 189, 234
BseMI GCAATG 1 cut(s) 214
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 1 cut(s) 328
BseXI GCAGC 2 cut(s) 136, 333
BshFI GGCC 1 cut(s) 334
BsmAI GTCTC 1 cut(s) 369
BsnI GGCC 1 cut(s) 334
Bsp143I GATC 6 cut(s) 33, 190, 235, 276, 417, 422
BspANI GGCC 1 cut(s) 334
BspCNI CTCAG 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 192
BspPI GGATC 3 cut(s) 185, 198, 284
BsrDI GCAATG 1 cut(s) 214
BsrI ACTGG 1 cut(s) 328
BssMI GATC 6 cut(s) 33, 190, 235, 276, 417, 422
BstDEI CTNAG 3 cut(s) 138, 144, 225
BstF5I GGATG 3 cut(s) 65, 123, 235
BstKTI GATC 6 cut(s) 36, 193, 238, 279, 420, 425
BstMAI GTCTC 1 cut(s) 369
BstMBI GATC 6 cut(s) 33, 190, 235, 276, 417, 422
BstNSI RCATGY 3 cut(s) 170, 204, 408
BstV1I GCAGC 2 cut(s) 136, 333
BstX2I RGATCY 2 cut(s) 190, 422
BstYI RGATCY 2 cut(s) 190, 422
BsuRI GGCC 1 cut(s) 334
BtsCI GGATG 3 cut(s) 65, 123, 235
BtsI GCAGTG 1 cut(s) 14
BtsIMutI CAGTG 3 cut(s) 14, 335, 465
Cfr13I GGNCC 1 cut(s) 333
Csp6I GTAC 3 cut(s) 306, 383, 442
CviAII CATG 5 cut(s) 13, 167, 201, 405, 415
CviJI RGCY 3 cut(s) 149, 324, 334
CviKI_1 RGCY 3 cut(s) 149, 324, 334
CviQI GTAC 3 cut(s) 306, 383, 442
DdeI CTNAG 3 cut(s) 138, 144, 225
DpnI GATC 6 cut(s) 35, 192, 237, 278, 419, 424
DpnII GATC 6 cut(s) 33, 190, 235, 276, 417, 422
EcoRI GAATTC 2 cut(s) 157, 452
FaeI CATG 5 cut(s) 16, 170, 204, 408, 418
FaiI YATR 8 cut(s) 14, 27, 55, 168, 202, 406, 416, 438
FatI CATG 5 cut(s) 12, 166, 200, 404, 414
FbaI TGATCA 1 cut(s) 417
Fnu4HI GCNGC 2 cut(s) 150, 322
FokI GGATG 3 cut(s) 52, 110, 242
Fsp4HI GCNGC 2 cut(s) 150, 322
FspBI CTAG 1 cut(s) 50
GluI GCNGC 2 cut(s) 150, 322
HaeIII GGCC 1 cut(s) 334
Hin1II CATG 5 cut(s) 16, 170, 204, 408, 418
HinfI GANTC 3 cut(s) 100, 243, 266
HphI GGTGA 1 cut(s) 341
Hpy166II GTNNAC 3 cut(s) 308, 361, 434
Hpy188I TCNGA 4 cut(s) 105, 302, 422, 427
Hpy188III TCNNGA 3 cut(s) 162, 263, 368
Hpy8I GTNNAC 3 cut(s) 308, 361, 434
HpyCH4V TGCA 5 cut(s) 12, 57, 219, 321, 408
HpyF3I CTNAG 3 cut(s) 138, 144, 225
Hsp92II CATG 5 cut(s) 16, 170, 204, 408, 418
Ksp22I TGATCA 1 cut(s) 417
Kzo9I GATC 6 cut(s) 33, 190, 235, 276, 417, 422
LpnPI CCDG 3 cut(s) 175, 224, 341
Lsp1109I GCAGC 2 cut(s) 136, 333
MaeI CTAG 1 cut(s) 50
MalI GATC 6 cut(s) 35, 192, 237, 278, 419, 424
MboI GATC 6 cut(s) 33, 190, 235, 276, 417, 422
MflI RGATCY 2 cut(s) 190, 422
MluCI AATT 6 cut(s) 29, 157, 174, 280, 340, 452
MlyI GAGTC 2 cut(s) 252, 275
MnlI CCTC 5 cut(s) 57, 137, 139, 296, 442
MslI CAYNNNNRTG 1 cut(s) 354
NdeII GATC 6 cut(s) 33, 190, 235, 276, 417, 422
NlaIII CATG 5 cut(s) 16, 170, 204, 408, 418
NlaIV GGNNCC 1 cut(s) 192
NspI RCATGY 3 cut(s) 170, 204, 408
PciI ACATGT 2 cut(s) 166, 200
PfeI GAWTC 1 cut(s) 100
PkrI GCNGC 2 cut(s) 151, 323
PleI GAGTC 2 cut(s) 251, 274
PpsI GAGTC 2 cut(s) 251, 274
PscI ACATGT 2 cut(s) 166, 200
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 1 cut(s) 333
PsuI RGATCY 2 cut(s) 190, 422
RsaI GTAC 3 cut(s) 307, 384, 443
RsaNI GTAC 3 cut(s) 306, 383, 442
RseI CAYNNNNRTG 1 cut(s) 354
SatI GCNGC 2 cut(s) 150, 322
Sau3AI GATC 6 cut(s) 33, 190, 235, 276, 417, 422
Sau96I GGNCC 1 cut(s) 333
SchI GAGTC 2 cut(s) 252, 275
SetI ASST 4 cut(s) 307, 326, 354, 443
SmiMI CAYNNNNRTG 1 cut(s) 354
Sse9I AATT 6 cut(s) 29, 157, 174, 280, 340, 452
SspMI CTAG 1 cut(s) 50
TaqI TCGA 1 cut(s) 36
TasI AATT 6 cut(s) 29, 157, 174, 280, 340, 452
TfiI GAWTC 1 cut(s) 100
TscAI CASTG 3 cut(s) 14, 335, 472
TseI GCWGC 2 cut(s) 149, 321
TspDTI ATGAA 4 cut(s) 112, 113, 203, 335
TspRI CASTG 3 cut(s) 14, 335, 472
XapI RAATTY 2 cut(s) 157, 452
XceI RCATGY 3 cut(s) 170, 204, 408
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.