Rorug04G0282500

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
45656153 .. 45656311
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0282500.1

Sequence Viewer

Length: 159 bp
ATGGTAGAACAAGCAACTTTAGATCCATCTTTAGAGAAAATTTTACATCTGATTTGCAATGGATACATGGAAGAAAAATATGAGTTTAGTGATCATTCGAGCCCCTTTGAATCCATCATTCCTGGTAAGATTCTAACTGAAATTATTTGGTGTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.01

Weight (kDa)

4.47

Isoelectric Point (pI)

54.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 17
AcsI RAATTY 1 cut(s) 39
AgsI TTSAA 1 cut(s) 110
AjnI CCWGG 1 cut(s) 121
AlwI GGATC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 39
BanII GRGCYC 1 cut(s) 104
BccI CCATC 2 cut(s) 34, 122
BciT130I CCWGG 1 cut(s) 123
BciVI GTATCC 1 cut(s) 56
BclI TGATCA 1 cut(s) 91
BfuI GTATCC 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 64
BseBI CCWGG 1 cut(s) 123
BseMI GCAATG 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 104
Bsp143I GATC 2 cut(s) 22, 91
BspPI GGATC 1 cut(s) 17
BsrDI GCAATG 1 cut(s) 64
BssMI GATC 2 cut(s) 22, 91
Bst2UI CCWGG 1 cut(s) 123
BstKTI GATC 2 cut(s) 25, 94
BstMBI GATC 2 cut(s) 22, 91
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
BsuI GTATCC 1 cut(s) 56
CviAII CATG 1 cut(s) 67
CviJI RGCY 1 cut(s) 102
CviKI_1 RGCY 1 cut(s) 102
DpnI GATC 2 cut(s) 24, 93
DpnII GATC 2 cut(s) 22, 91
Eco24I GRGCYC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 121
EcoT38I GRGCYC 1 cut(s) 104
FaeI CATG 1 cut(s) 70
FaiI YATR 2 cut(s) 68, 81
FatI CATG 1 cut(s) 66
FbaI TGATCA 1 cut(s) 91
FriOI GRGCYC 1 cut(s) 104
Hin1II CATG 1 cut(s) 70
HinfI GANTC 2 cut(s) 110, 130
Hpy188I TCNGA 1 cut(s) 51
HpyCH4V TGCA 1 cut(s) 57
Hsp92II CATG 1 cut(s) 70
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 2 cut(s) 22, 91
LpnPI CCDG 2 cut(s) 108, 135
MalI GATC 2 cut(s) 24, 93
MboI GATC 2 cut(s) 22, 91
MboII GAAGA 1 cut(s) 83
MflI RGATCY 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 104
MluCI AATT 2 cut(s) 39, 141
MseI TTAA 1 cut(s) 157
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
NdeII GATC 2 cut(s) 22, 91
NlaIII CATG 1 cut(s) 70
PfeI GAWTC 2 cut(s) 110, 130
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PsuI RGATCY 1 cut(s) 22
SaqAI TTAA 1 cut(s) 157
Sau3AI GATC 2 cut(s) 22, 91
ScrFI CCNGG 1 cut(s) 123
SduI GDGCHC 1 cut(s) 104
SgeI CNNG 5 cut(s) 23, 79, 111, 134, 135
Sse9I AATT 2 cut(s) 39, 141
StyD4I CCNGG 1 cut(s) 121
TaqI TCGA 1 cut(s) 98
TasI AATT 2 cut(s) 39, 141
TfiI GAWTC 2 cut(s) 110, 130
Tru1I TTAA 1 cut(s) 157
Tru9I TTAA 1 cut(s) 157
XapI RAATTY 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.