Rorug05G0534700

Serine carboxypeptidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0002263
Physical Location & Seq
Reverse (-)
72264679 .. 72266253
1575 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0534700.1

Sequence Viewer

Length: 219 bp
ATGGGGAAGCAACCGGTGAGGATGAAGGCGGTGGTATACGCGCTGTCGCCGTTTCAGCAGAAGGTGATGCCGGGTCTCTGGAAAGATCTGCCGACGAAGATCCACCACAAGATCTCCGAGAACTGGCACAGCGCTATCTTCCTCCTCGGACCCATCGTCGGAACCTATGCGTATGTCCAGAACTACAAGGAAAAGGAGAAGTTGGAGCATAGGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

72

Amino Acids

8.45

Weight (kDa)

9.79

Isoelectric Point (pI)

46.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyt_b-c1_8 PF10890 1 - 72 1.9e-38 Cytochrome b-c1 complex subunit 8
UcrQ PF02939 9 - 65 7.2e-06 UcrQ family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 36
AccII CGCG 1 cut(s) 41
AciI CCGC 1 cut(s) 29
AclWI GGATC 1 cut(s) 94
AfeI AGCGCT 1 cut(s) 133
AfiI CCNNNNNNNGG 2 cut(s) 123, 158
AgeI ACCGGT 1 cut(s) 13
AhdI GACNNNNNGTC 1 cut(s) 155
AloI GAACNNNNNNTCC 1 cut(s) 197
Alw26I GTCTC 1 cut(s) 80
AlwI GGATC 1 cut(s) 94
Aor51HI AGCGCT 1 cut(s) 133
AsiGI ACCGGT 1 cut(s) 13
AspLEI GCGC 2 cut(s) 43, 134
AspS9I GGNCC 1 cut(s) 149
AsuC2I CCSGG 1 cut(s) 72
AsuHPI GGTGA 2 cut(s) 28, 76
AvaII GGWCC 1 cut(s) 149
BccI CCATC 1 cut(s) 161
BceAI ACGGC 1 cut(s) 34
BcnI CCSGG 1 cut(s) 72
BcoDI GTCTC 1 cut(s) 80
BfoI RGCGCY 1 cut(s) 135
BglII AGATCT 2 cut(s) 85, 111
Bme1390I CCNGG 1 cut(s) 72
Bme18I GGWCC 1 cut(s) 149
BmeRI GACNNNNNGTC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 2 cut(s) 151, 163
BmrFI CCNGG 1 cut(s) 72
BmsI GCATC 1 cut(s) 57
BpuMI CCSGG 1 cut(s) 72
BsaI GGTCTC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 145
BsaWI WCCGGW 1 cut(s) 13
BsaXI ACNNNNNCTCC 3 cut(s) 98, 128, 197
Bsc4I CCNNNNNNNGG 2 cut(s) 123, 158
Bse118I RCCGGY 1 cut(s) 13
Bse1I ACTGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 145
BseGI GGATG 1 cut(s) 27
BseLI CCNNNNNNNGG 2 cut(s) 123, 158
BseNI ACTGG 1 cut(s) 128
BseRI GAGGAG 1 cut(s) 134
Bsh1236I CGCG 1 cut(s) 41
BshTI ACCGGT 1 cut(s) 13
BsiSI CCGG 2 cut(s) 14, 71
BslI CCNNNNNNNGG 2 cut(s) 123, 158
BsmAI GTCTC 1 cut(s) 80
Bso31I GGTCTC 1 cut(s) 80
Bsp143I GATC 3 cut(s) 85, 99, 111
BspACI CCGC 1 cut(s) 29
BspFNI CGCG 1 cut(s) 41
BspLI GGNNCC 2 cut(s) 151, 163
BspPI GGATC 1 cut(s) 94
BspTNI GGTCTC 1 cut(s) 80
BsrFI RCCGGY 1 cut(s) 13
BsrI ACTGG 1 cut(s) 128
BssAI RCCGGY 1 cut(s) 13
BssECI CCNNGG 1 cut(s) 145
BssMI GATC 3 cut(s) 85, 99, 111
BssNAI GTATAC 1 cut(s) 37
Bst1107I GTATAC 1 cut(s) 37
BstF5I GGATG 1 cut(s) 27
BstFNI CGCG 1 cut(s) 41
BstH2I RGCGCY 1 cut(s) 135
BstHHI GCGC 2 cut(s) 43, 134
BstKTI GATC 3 cut(s) 88, 102, 114
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 3 cut(s) 85, 99, 111
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 70
BstUI CGCG 1 cut(s) 41
BstX2I RGATCY 3 cut(s) 85, 99, 111
BstYI RGATCY 3 cut(s) 85, 99, 111
BstZ17I GTATAC 1 cut(s) 37
BtsCI GGATG 1 cut(s) 27
CfoI GCGC 2 cut(s) 43, 134
Cfr10I RCCGGY 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 149
CspAI ACCGGT 1 cut(s) 13
DpnI GATC 3 cut(s) 87, 101, 113
DpnII GATC 3 cut(s) 85, 99, 111
DriI GACNNNNNGTC 1 cut(s) 155
Eam1105I GACNNNNNGTC 1 cut(s) 155
Eco31I GGTCTC 1 cut(s) 80
Eco47I GGWCC 1 cut(s) 149
Eco47III AGCGCT 1 cut(s) 133
FaiI YATR 4 cut(s) 37, 168, 174, 210
FblI GTMKAC 1 cut(s) 36
FokI GGATG 1 cut(s) 34
GlaI GCGC 2 cut(s) 42, 133
HaeII RGCGCY 1 cut(s) 135
HapII CCGG 2 cut(s) 14, 71
HhaI GCGC 2 cut(s) 43, 134
Hin6I GCGC 2 cut(s) 41, 132
HinP1I GCGC 2 cut(s) 41, 132
HpaII CCGG 2 cut(s) 14, 71
HphI GGTGA 2 cut(s) 28, 76
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 4 cut(s) 118, 149, 161, 218
Hpy188III TCNNGA 2 cut(s) 79, 178
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 2 cut(s) 97, 161
HpyAV CCTTC 2 cut(s) 19, 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HspAI GCGC 2 cut(s) 41, 132
Kzo9I GATC 3 cut(s) 85, 99, 111
LmnI GCTCC 1 cut(s) 205
LpnPI CCDG 5 cut(s) 27, 64, 84, 109, 191
LweI GCATC 1 cut(s) 57
MalI GATC 3 cut(s) 87, 101, 113
MboI GATC 3 cut(s) 85, 99, 111
MboII GAAGA 2 cut(s) 109, 130
MflI RGATCY 3 cut(s) 85, 99, 111
MmeI TCCRAC 2 cut(s) 139, 183
MnlI CCTC 3 cut(s) 12, 152, 155
MspI CCGG 2 cut(s) 14, 71
MspR9I CCNGG 1 cut(s) 72
MvnI CGCG 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 55
NciI CCSGG 1 cut(s) 72
NdeII GATC 3 cut(s) 85, 99, 111
NlaIV GGNNCC 2 cut(s) 151, 163
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PinAI ACCGGT 1 cut(s) 13
PspN4I GGNNCC 2 cut(s) 151, 163
PspPI GGNCC 1 cut(s) 149
PsuI RGATCY 3 cut(s) 85, 99, 111
Sau3AI GATC 3 cut(s) 85, 99, 111
Sau96I GGNCC 1 cut(s) 149
ScrFI CCNGG 1 cut(s) 72
SetI ASST 3 cut(s) 66, 167, 215
SfaNI GCATC 1 cut(s) 57
SinI GGWCC 1 cut(s) 149
SsiI CCGC 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 70
TspDTI ATGAA 1 cut(s) 38
VpaK11BI GGWCC 1 cut(s) 149
XmiI GTMKAC 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.