Rorug05G0534800

Serine carboxypeptidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0002263
Physical Location & Seq
Forward (+)
72304919 .. 72306731
1813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0534800.1

Sequence Viewer

Length: 249 bp
ATGGGTTGTTTTGGTATAGATCTGGGGAAGATTCTGACCTCATACTTGTGGCATTGGAGCTTCAGCAAGGTTGCACAGGTAACCATGGTTGAAGCTAAGTGCGTCAAAAGTTTACGTGCTGTATTTAAAGAGGATTTTGCGATTATTGTCCTCACCAATCCCACCAATCCAGACTGCAATCCACCAAATCAGAGGTGCATCATTATAGACATTTTACAGTTACACAGTCTTTCTCAACAGGTTGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

82

Amino Acids

9.23

Weight (kDa)

7.68

Isoelectric Point (pI)

17.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 46
AgsI TTSAA 1 cut(s) 92
AluBI AGCT 2 cut(s) 60, 95
AluI AGCT 2 cut(s) 60, 95
AsuHPI GGTGA 1 cut(s) 145
BglII AGATCT 1 cut(s) 19
BmsI GCATC 1 cut(s) 207
BsaAI YACGTR 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 19
Bsp19I CCATGG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 84
Bst4CI ACNGT 2 cut(s) 219, 227
BstBAI YACGTR 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 96
BstDSI CCRYGG 1 cut(s) 84
BstEII GGTNACC 1 cut(s) 79
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstPI GGTNACC 1 cut(s) 79
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
BtgI CCRYGG 1 cut(s) 84
CseI GACGC 1 cut(s) 91
CviAII CATG 1 cut(s) 85
CviJI RGCY 2 cut(s) 60, 95
CviKI_1 RGCY 2 cut(s) 60, 95
DdeI CTNAG 1 cut(s) 96
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
DraI TTTAAA 1 cut(s) 127
Eco130I CCWWGG 1 cut(s) 84
Eco57I CTGAAG 1 cut(s) 46
Eco91I GGTNACC 1 cut(s) 79
EcoO65I GGTNACC 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 88
FaiI YATR 5 cut(s) 17, 43, 86, 206, 247
FatI CATG 1 cut(s) 84
HgaI GACGC 1 cut(s) 91
Hin1II CATG 1 cut(s) 88
HinfI GANTC 1 cut(s) 31
HphI GGTGA 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 36, 192
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 113
HpyCH4III ACNGT 2 cut(s) 219, 227
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 3 cut(s) 74, 177, 198
HpyF3I CTNAG 1 cut(s) 96
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 1 cut(s) 88
Kzo9I GATC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 57
LpnPI CCDG 4 cut(s) 8, 62, 183, 224
LweI GCATC 1 cut(s) 207
MaeII ACGT 1 cut(s) 115
MaeIII GTNAC 2 cut(s) 79, 219
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 1 cut(s) 40
MflI RGATCY 1 cut(s) 19
MnlI CCTC 4 cut(s) 49, 124, 161, 186
MseI TTAA 1 cut(s) 126
MslI CAYNNNNRTG 1 cut(s) 46
NcoI CCATGG 1 cut(s) 84
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 88
PfeI GAWTC 1 cut(s) 31
Ppu21I YACGTR 1 cut(s) 116
PspEI GGTNACC 1 cut(s) 79
PsuI RGATCY 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 46
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 19
SetI ASST 8 cut(s) 41, 62, 72, 81, 97, 118, 197, 243
SfaNI GCATC 1 cut(s) 207
SgeI CNNG 7 cut(s) 35, 58, 79, 89, 97, 128, 182
SmiMI CAYNNNNRTG 1 cut(s) 46
StyI CCWWGG 1 cut(s) 84
TaaI ACNGT 2 cut(s) 219, 227
TaiI ACGT 1 cut(s) 118
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.