Rorug06G0103000

Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
13683311 .. 13684742
1432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0103000.1

Sequence Viewer

Length: 372 bp
ATGGTAGACCAAGGAAACTCATCTTGTTCTAAGCACCTCGGTCCTTTGGATCATTGCAAAGAGAATTTAGGTAAGCACAATCCAAGCTCTAAATCTGATTACTCAAAGAGGTTCAAAAAGAGGAAGAAGATTATGAAGATAACTGCTGAAGTATCTGCTGAACAGTTCAGATCCGAGTACCCCCATTTTAAAGAAAAAATTAGCAGACGTGATCCAGAGCATCTGGGAACACCCTTCAATAAGGAGCATCTTCAGGCAATTATAAAGTTGTTTCCAGCCTCAACGCAAATGATATACTTGACTGAAGATAGTATGCTTTTGCACTTGATAACAGAGTTAAAGTCGGTAGGGTTTGCCTATTTGAGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

14.2

Weight (kDa)

9.37

Isoelectric Point (pI)

41.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 263
AccI GTMKAC 1 cut(s) 6
AclWI GGATC 3 cut(s) 57, 165, 206
AcsI RAATTY 1 cut(s) 64
AcuI CTGAAG 3 cut(s) 168, 236, 324
AfaI GTAC 1 cut(s) 179
AgsI TTSAA 2 cut(s) 115, 238
AjiI CACGTC 1 cut(s) 209
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
AlwI GGATC 3 cut(s) 57, 165, 206
ApoI RAATTY 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
Bme18I GGWCC 1 cut(s) 41
BmgBI CACGTC 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 41
BmsI GCATC 2 cut(s) 229, 256
BsaJI CCNNGG 2 cut(s) 10, 37
Bse3DI GCAATG 1 cut(s) 52
BseDI CCNNGG 2 cut(s) 10, 37
BseMI GCAATG 1 cut(s) 52
Bsp143I GATC 3 cut(s) 49, 170, 211
BspPI GGATC 3 cut(s) 57, 165, 206
BsrDI GCAATG 1 cut(s) 52
BssECI CCNNGG 2 cut(s) 10, 37
BssMI GATC 3 cut(s) 49, 170, 211
BssT1I CCWWGG 1 cut(s) 10
Bst4CI ACNGT 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 30
BstKTI GATC 3 cut(s) 52, 173, 214
BstMBI GATC 3 cut(s) 49, 170, 211
BstX2I RGATCY 1 cut(s) 170
BstYI RGATCY 1 cut(s) 170
BtrI CACGTC 1 cut(s) 209
Cfr13I GGNCC 1 cut(s) 41
Csp6I GTAC 1 cut(s) 178
CviJI RGCY 2 cut(s) 87, 278
CviKI_1 RGCY 2 cut(s) 87, 278
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 1 cut(s) 30
DpnI GATC 3 cut(s) 51, 172, 213
DpnII GATC 3 cut(s) 49, 170, 211
DraI TTTAAA 1 cut(s) 190
Eco130I CCWWGG 1 cut(s) 10
Eco47I GGWCC 1 cut(s) 41
Eco57I CTGAAG 3 cut(s) 168, 236, 324
EcoT14I CCWWGG 1 cut(s) 10
ErhI CCWWGG 1 cut(s) 10
FaiI YATR 4 cut(s) 134, 263, 295, 314
FblI GTMKAC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 3 cut(s) 97, 170, 175
Hpy188III TCNNGA 1 cut(s) 215
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 244
HpyCH4III ACNGT 1 cut(s) 165
HpyCH4IV ACGT 1 cut(s) 208
HpyCH4V TGCA 2 cut(s) 57, 322
HpyF3I CTNAG 1 cut(s) 30
HpySE526I ACGT 1 cut(s) 208
Kzo9I GATC 3 cut(s) 49, 170, 211
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 4 cut(s) 209, 228, 239, 288
LweI GCATC 2 cut(s) 229, 256
MaeII ACGT 1 cut(s) 208
MalI GATC 3 cut(s) 51, 172, 213
MboI GATC 3 cut(s) 49, 170, 211
MboII GAAGA 5 cut(s) 136, 139, 148, 242, 317
MflI RGATCY 1 cut(s) 170
MluCI AATT 3 cut(s) 64, 198, 258
MnlI CCTC 4 cut(s) 47, 102, 114, 289
MseI TTAA 2 cut(s) 189, 338
NdeII GATC 3 cut(s) 49, 170, 211
PsiI TTATAA 1 cut(s) 263
PspPI GGNCC 1 cut(s) 41
PsuI RGATCY 1 cut(s) 170
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SaqAI TTAA 2 cut(s) 189, 338
Sau3AI GATC 3 cut(s) 49, 170, 211
Sau96I GGNCC 1 cut(s) 41
SetI ASST 5 cut(s) 39, 73, 89, 113, 211
SfaNI GCATC 2 cut(s) 229, 256
SinI GGWCC 1 cut(s) 41
Sse9I AATT 3 cut(s) 64, 198, 258
StyI CCWWGG 1 cut(s) 10
TaaI ACNGT 1 cut(s) 165
TaiI ACGT 1 cut(s) 211
TaqII GACCGA 1 cut(s) 29
TasI AATT 3 cut(s) 64, 198, 258
Tru1I TTAA 2 cut(s) 189, 338
Tru9I TTAA 2 cut(s) 189, 338
TspDTI ATGAA 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 41
XapI RAATTY 1 cut(s) 64
XmiI GTMKAC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.