Rorug06G0467600

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
59170950 .. 59171210
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0467600.1

Sequence Viewer

Length: 201 bp
ATGGTCGATTTGCATCTTTCTGTGGTGTTCAAAGCCCTTCACTTGGAGAAAAACGATCTTCGAATTCAGGATGGAAATAAACAAACGCAGGATCACACACTAAGTGGCGAAGTATCTTCAGTAGATATAGCAACAGAGAAGAATCTGGACCATCTTCTCAAAGTTGGTGAAGGACTATTGACAACCAGTTTCCAGGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.29

Weight (kDa)

5.34

Isoelectric Point (pI)

15.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 99
AcsI RAATTY 1 cut(s) 63
AcuI CTGAAG 1 cut(s) 102
AdeI CACNNNGTG 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 192
AlwI GGATC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 179
AsuII TTCGAA 1 cut(s) 61
AvaII GGWCC 1 cut(s) 148
BccI CCATC 2 cut(s) 65, 159
BciT130I CCWGG 1 cut(s) 194
Bme1390I CCNGG 1 cut(s) 194
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 1 cut(s) 22
Bpu14I TTCGAA 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 193
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 186
Bse8I GATNNNNATC 1 cut(s) 12
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 1 cut(s) 193
BseGI GGATG 1 cut(s) 76
BseJI GATNNNNATC 1 cut(s) 12
BseLI CCNNNNNNNGG 1 cut(s) 43
BseNI ACTGG 1 cut(s) 186
BslI CCNNNNNNNGG 1 cut(s) 43
Bsp119I TTCGAA 1 cut(s) 61
Bsp143I GATC 2 cut(s) 55, 91
BspPI GGATC 1 cut(s) 99
BspT104I TTCGAA 1 cut(s) 61
BsrI ACTGG 1 cut(s) 186
BssECI CCNNGG 1 cut(s) 193
BssMI GATC 2 cut(s) 55, 91
Bst2UI CCWGG 1 cut(s) 194
BstBI TTCGAA 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 2 cut(s) 58, 94
BstMBI GATC 2 cut(s) 55, 91
BstNI CCWGG 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 192
BtsCI GGATG 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 148
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
DdeI CTNAG 1 cut(s) 101
DpnI GATC 2 cut(s) 57, 93
DpnII GATC 2 cut(s) 55, 91
DraIII CACNNNGTG 1 cut(s) 104
Eco47I GGWCC 1 cut(s) 148
Eco57I CTGAAG 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 192
FaiI YATR 1 cut(s) 128
FokI GGATG 1 cut(s) 83
HinfI GANTC 1 cut(s) 142
HphI GGTGA 1 cut(s) 179
Hpy188III TCNNGA 2 cut(s) 68, 146
HpyAV CCTTC 2 cut(s) 47, 164
HpyCH4V TGCA 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 101
Kzo9I GATC 2 cut(s) 55, 91
LpnPI CCDG 4 cut(s) 53, 74, 131, 179
LweI GCATC 1 cut(s) 22
MalI GATC 2 cut(s) 57, 93
MboI GATC 2 cut(s) 55, 91
MboII GAAGA 4 cut(s) 50, 108, 146, 151
MluCI AATT 1 cut(s) 63
MseI TTAA 1 cut(s) 199
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 2 cut(s) 55, 91
NspV TTCGAA 1 cut(s) 61
PfeI GAWTC 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
PspPI GGNCC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 199
Sau3AI GATC 2 cut(s) 55, 91
Sau96I GGNCC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 194
SfaNI GCATC 1 cut(s) 22
SfuI TTCGAA 1 cut(s) 61
SgeI CNNG 4 cut(s) 55, 80, 101, 158
SinI GGWCC 1 cut(s) 148
Sse9I AATT 1 cut(s) 63
StyD4I CCNGG 1 cut(s) 192
TaqI TCGA 2 cut(s) 6, 61
TasI AATT 1 cut(s) 63
TfiI GAWTC 1 cut(s) 142
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 148
XapI RAATTY 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.