Rorug07G0072600

Acid phosphatase homologues

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
5559097 .. 5560259
1163 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0072600.1

Sequence Viewer

Length: 237 bp
ATGGATTCTAGTTTTAAAACCATTGCTGTCATTCTCTTACTCTTTCTAGGCATTTGTGCAGGAAGAGATGCCAAAGGCTTCAGGAATGTTGTAAACCCTACAAACCCATCAAAAGAGGTGATTGTGGAAATGAAGATGAGAGACCTGACAGAAATTGATGCTTTTGTGGACTATGAAAAGCCAATGCCAAATCCTAGGCATGAAAAAGGGAAGCCAGGTGGTGGTGCTAATAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.6

Weight (kDa)

8.85

Isoelectric Point (pI)

25.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 221
AcuI CTGAAG 1 cut(s) 64
AfiI CCNNNNNNNGG 1 cut(s) 221
AjnI CCWGG 1 cut(s) 214
Alw26I GTCTC 1 cut(s) 135
AspA2I CCTAGG 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 130
AvrII CCTAGG 1 cut(s) 194
BccI CCATC 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 216
BcoDI GTCTC 1 cut(s) 135
BfaI CTAG 3 cut(s) 9, 47, 195
BlnI CCTAGG 1 cut(s) 194
Bme1390I CCNGG 1 cut(s) 216
BmrFI CCNGG 1 cut(s) 216
BmsI GCATC 2 cut(s) 58, 148
BsaI GGTCTC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse3DI GCAATG 1 cut(s) 21
BseBI CCWGG 1 cut(s) 216
BseDI CCNNGG 1 cut(s) 194
BseLI CCNNNNNNNGG 1 cut(s) 221
BseMI GCAATG 1 cut(s) 21
BsgI GTGCAG 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 221
BsmAI GTCTC 1 cut(s) 135
Bso31I GGTCTC 1 cut(s) 135
BspTNI GGTCTC 1 cut(s) 135
BsrDI GCAATG 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 194
BssT1I CCWWGG 1 cut(s) 194
Bst2UI CCWGG 1 cut(s) 216
Bst6I CTCTTC 1 cut(s) 58
BstMAI GTCTC 1 cut(s) 135
BstNI CCWGG 1 cut(s) 216
BstSCI CCNGG 1 cut(s) 214
CviAII CATG 1 cut(s) 200
CviJI RGCY 3 cut(s) 78, 181, 214
CviKI_1 RGCY 3 cut(s) 78, 181, 214
DraI TTTAAA 1 cut(s) 16
Eam1104I CTCTTC 1 cut(s) 58
EarI CTCTTC 1 cut(s) 58
Eco130I CCWWGG 1 cut(s) 194
Eco31I GGTCTC 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 214
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 1 cut(s) 203
FaiI YATR 2 cut(s) 174, 201
FatI CATG 1 cut(s) 199
FspBI CTAG 3 cut(s) 9, 47, 195
Hin1II CATG 1 cut(s) 203
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 2 cut(s) 94, 169
Hpy188III TCNNGA 1 cut(s) 82
Hpy8I GTNNAC 2 cut(s) 94, 169
HpyCH4V TGCA 1 cut(s) 59
Hsp92II CATG 1 cut(s) 203
LpnPI CCDG 5 cut(s) 45, 67, 158, 201, 228
LweI GCATC 2 cut(s) 58, 148
MaeI CTAG 3 cut(s) 9, 47, 195
MboII GAAGA 2 cut(s) 75, 145
MluCI AATT 1 cut(s) 153
MnlI CCTC 1 cut(s) 109
MseI TTAA 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 216
MvaI CCWGG 1 cut(s) 216
NlaIII CATG 1 cut(s) 203
PfeI GAWTC 1 cut(s) 5
PflMI CCANNNNNTGG 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 214
PspGI CCWGG 1 cut(s) 214
SaqAI TTAA 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 216
SetI ASST 3 cut(s) 120, 147, 220
SfaNI GCATC 2 cut(s) 58, 148
SgeI CNNG 9 cut(s) 21, 59, 72, 94, 157, 207, 212, 227, 228
Sse9I AATT 1 cut(s) 153
SspMI CTAG 3 cut(s) 9, 47, 195
StyD4I CCNGG 1 cut(s) 214
StyI CCWWGG 1 cut(s) 194
TasI AATT 1 cut(s) 153
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 3 cut(s) 146, 189, 216
Van91I CCANNNNNTGG 1 cut(s) 221
XmaJI CCTAGG 1 cut(s) 194
XspI CTAG 3 cut(s) 9, 47, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.