Rh1AG369000

Proline-rich protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0004472
Physical Location & Seq
Reverse (-)
60312200 .. 60312568
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG369000.1

Sequence Viewer

Length: 369 bp
ATGGCGAGCAAGCAACTCATCCTCGTCGCGTCATCTTTTCTTCTCATTGCATTGGCCTTCTTCCCTTCCACAACCGCCACCGCATACCCTTCAAAGTCCGAAGTGCATGTGGTTGTGGAAGGCATGGTCTACTGCCAGAGATGTGACTACAGTGGATGGTCCTTAACTGGAGCTACACCACTCCCTTCGGCTAAAGTCAGCGTTGTCTGCAAAAACAACATAGGCCAAGTTGGTTACTACAAGACTTTCCAAGCAAATGCTAATGGCTATGTGTATGCTGAGCTAGAAGGCAACAAAATGAACAGTGTAATAGATTATCCCCTTCAGAATTGCCTAGTGAAGTTAGTCTCTTCTCCTCTTCAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

122

Amino Acids

13.24

Weight (kDa)

8.68

Isoelectric Point (pI)

44.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 39 - 121 1e-18 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 129
AccII CGCG 1 cut(s) 29
AciI CCGC 2 cut(s) 75, 81
AcuI CTGAAG 2 cut(s) 308, 344
AgsI TTSAA 1 cut(s) 93
AluBI AGCT 2 cut(s) 173, 283
AluI AGCT 2 cut(s) 173, 283
Alw26I GTCTC 1 cut(s) 352
AoxI GGCC 2 cut(s) 54, 223
AspS9I GGNCC 1 cut(s) 159
AvaII GGWCC 1 cut(s) 159
BccI CCATC 1 cut(s) 150
BcoDI GTCTC 1 cut(s) 352
BfaI CTAG 2 cut(s) 284, 335
BfmI CTRYAG 1 cut(s) 148
BlpI GCTNAGC 1 cut(s) 279
Bme18I GGWCC 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 159
BpmI CTGGAG 1 cut(s) 189
Bpu1102I GCTNAGC 1 cut(s) 279
Bse1I ACTGG 1 cut(s) 172
Bse3DI GCAATG 1 cut(s) 45
BseGI GGATG 2 cut(s) 18, 161
BseMI GCAATG 1 cut(s) 45
BseMII CTCAG 1 cut(s) 270
BseNI ACTGG 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 345
Bsh1236I CGCG 1 cut(s) 29
BshFI GGCC 2 cut(s) 56, 225
BsmAI GTCTC 1 cut(s) 352
BsnI GGCC 2 cut(s) 56, 225
Bsp1720I GCTNAGC 1 cut(s) 279
BspACI CCGC 2 cut(s) 75, 81
BspANI GGCC 2 cut(s) 56, 225
BspCNI CTCAG 1 cut(s) 271
BspFNI CGCG 1 cut(s) 29
BsrDI GCAATG 1 cut(s) 45
BsrI ACTGG 1 cut(s) 172
Bst4CI ACNGT 2 cut(s) 152, 305
Bst6I CTCTTC 2 cut(s) 355, 363
BstC8I GCNNGC 2 cut(s) 7, 11
BstDEI CTNAG 1 cut(s) 279
BstF5I GGATG 2 cut(s) 18, 161
BstFNI CGCG 1 cut(s) 29
BstMAI GTCTC 1 cut(s) 352
BstMWI GCNNNNNNNGC 1 cut(s) 207
BstNSI RCATGY 1 cut(s) 110
BstSFI CTRYAG 1 cut(s) 148
BstUI CGCG 1 cut(s) 29
BsuRI GGCC 2 cut(s) 56, 225
BtsCI GGATG 2 cut(s) 18, 161
BtsIMutI CAGTG 2 cut(s) 157, 310
Cac8I GCNNGC 2 cut(s) 7, 11
Cfr13I GGNCC 1 cut(s) 159
CseI GACGC 1 cut(s) 18
CviAII CATG 2 cut(s) 107, 124
CviJI RGCY 6 cut(s) 56, 173, 191, 225, 267, 283
CviKI_1 RGCY 6 cut(s) 56, 173, 191, 225, 267, 283
DdeI CTNAG 1 cut(s) 279
Eam1104I CTCTTC 2 cut(s) 355, 363
EarI CTCTTC 2 cut(s) 355, 363
Eco47I GGWCC 1 cut(s) 159
Eco57I CTGAAG 2 cut(s) 308, 344
FaeI CATG 2 cut(s) 110, 127
FaiI YATR 6 cut(s) 85, 108, 125, 221, 270, 276
FatI CATG 2 cut(s) 106, 123
FblI GTMKAC 1 cut(s) 129
FokI GGATG 2 cut(s) 5, 168
FspBI CTAG 2 cut(s) 284, 335
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 2 cut(s) 56, 225
HgaI GACGC 1 cut(s) 18
Hin1II CATG 2 cut(s) 110, 127
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 3 cut(s) 100, 327, 363
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 1 cut(s) 29
HpyAV CCTTC 7 cut(s) 67, 75, 99, 113, 195, 281, 332
HpyCH4III ACNGT 2 cut(s) 152, 305
HpyCH4V TGCA 3 cut(s) 50, 106, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 207
HpyF3I CTNAG 1 cut(s) 279
Hsp92II CATG 2 cut(s) 110, 127
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 2 cut(s) 149, 153
MaeI CTAG 2 cut(s) 284, 335
MaeIII GTNAC 2 cut(s) 143, 233
MboII GAAGA 4 cut(s) 32, 52, 342, 350
MluCI AATT 1 cut(s) 328
MnlI CCTC 2 cut(s) 32, 366
MseI TTAA 1 cut(s) 164
MvnI CGCG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 207
NlaIII CATG 2 cut(s) 110, 127
NmuCI GTSAC 1 cut(s) 143
NspI RCATGY 1 cut(s) 110
PspPI GGNCC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 164
Sau96I GGNCC 1 cut(s) 159
SetI ASST 2 cut(s) 175, 285
SfcI CTRYAG 1 cut(s) 148
SinI GGWCC 1 cut(s) 159
Sse9I AATT 1 cut(s) 328
SsiI CCGC 2 cut(s) 75, 81
SspMI CTAG 2 cut(s) 284, 335
TaaI ACNGT 2 cut(s) 152, 305
TasI AATT 1 cut(s) 328
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 2 cut(s) 157, 310
TseFI GTSAC 1 cut(s) 143
Tsp45I GTSAC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 314
TspRI CASTG 2 cut(s) 157, 310
VpaK11BI GGWCC 1 cut(s) 159
XceI RCATGY 1 cut(s) 110
XmiI GTMKAC 1 cut(s) 129
XspI CTAG 2 cut(s) 284, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.