Rh1AG369100

Proline-rich protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0004472
Physical Location & Seq
Reverse (-)
60317856 .. 60318215
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG369100.1

Sequence Viewer

Length: 360 bp
ATGACCGGGGCTAAACCAATCCCTTCGGCTAAAATCAGTGTCATCTGCAAGAACCACAAGGACCAAGTCAGCTTCTACAAGGCTTTCCAAACAAATGCGGATGGCTACTTCTATGCACACCTTGATGGCTTCAAAATGAACCACATGTTGGACCATCCCCTCCAGGCTTGCCATGTCAAGCCGGTTTCTTCACCTCTCGAAGACTGCAGGTTGCTCAGCAACATCAACTATGGCCTCTCTGGAGCTCCACTTCGTTATGAAGACAAGAGAGTGATGGGAAGCAGTTATGAAGCTGTGGTGTTTTCTGCAGGGCCTTTGGCTTTTCGCCCTGAGTCTTGCACTCCAAAAACTCACTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

119

Amino Acids

13.26

Weight (kDa)

8.68

Isoelectric Point (pI)

54.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 2 - 81 3.5e-17 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 198
AccB7I CCANNNNNTGG 1 cut(s) 148
AciI CCGC 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 148
AflIII ACRYGT 1 cut(s) 144
AgsI TTSAA 1 cut(s) 133
AjnI CCWGG 1 cut(s) 162
AjuI GAANNNNNNNTTGG 2 cut(s) 131, 163
AluBI AGCT 3 cut(s) 72, 245, 293
AluI AGCT 3 cut(s) 72, 245, 293
Alw21I GWGCWC 1 cut(s) 247
AoxI GGCC 2 cut(s) 232, 311
AspS9I GGNCC 3 cut(s) 61, 151, 311
AsuC2I CCSGG 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 183
AvaII GGWCC 2 cut(s) 61, 151
BanII GRGCYC 1 cut(s) 247
BbsI GAAGAC 2 cut(s) 207, 267
Bbv12I GWGCWC 1 cut(s) 247
BccI CCATC 4 cut(s) 95, 119, 162, 268
BciT130I CCWGG 1 cut(s) 164
BcnI CCSGG 1 cut(s) 7
BfmI CTRYAG 2 cut(s) 205, 306
BfuAI ACCTGC 1 cut(s) 198
BlpI GCTNAGC 1 cut(s) 215
Bme1390I CCNGG 2 cut(s) 7, 164
Bme18I GGWCC 2 cut(s) 61, 151
BmgT120I GGNCC 3 cut(s) 61, 151, 311
BmrFI CCNGG 2 cut(s) 7, 164
BpiI GAAGAC 2 cut(s) 207, 267
BpmI CTGGAG 2 cut(s) 146, 261
Bpu1102I GCTNAGC 1 cut(s) 215
BpuMI CCSGG 1 cut(s) 7
BsaJI CCNNGG 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse118I RCCGGY 1 cut(s) 181
BseBI CCWGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 6
BseGI GGATG 2 cut(s) 106, 154
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMII CTCAG 2 cut(s) 229, 321
BshFI GGCC 2 cut(s) 234, 313
BsiHKAI GWGCWC 1 cut(s) 247
BsiSI CCGG 2 cut(s) 6, 182
BslI CCNNNNNNNGG 1 cut(s) 148
BsnI GGCC 2 cut(s) 234, 313
Bsp1286I GDGCHC 1 cut(s) 247
Bsp1720I GCTNAGC 1 cut(s) 215
BspACI CCGC 1 cut(s) 98
BspANI GGCC 2 cut(s) 234, 313
BspCNI CTCAG 2 cut(s) 228, 322
BspMAI CTGCAG 2 cut(s) 209, 310
BspMI ACCTGC 1 cut(s) 198
BsrFI RCCGGY 1 cut(s) 181
BssAI RCCGGY 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 6
Bst2UI CCWGG 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 2 cut(s) 215, 330
BstF5I GGATG 2 cut(s) 106, 154
BstNI CCWGG 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 2 cut(s) 5, 162
BstSFI CTRYAG 2 cut(s) 205, 306
BstV2I GAAGAC 2 cut(s) 207, 267
BsuRI GGCC 2 cut(s) 234, 313
BtsCI GGATG 2 cut(s) 106, 154
BtsIMutI CAGTG 1 cut(s) 43
BveI ACCTGC 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 169
Cfr10I RCCGGY 1 cut(s) 181
Cfr13I GGNCC 3 cut(s) 61, 151, 311
CviAII CATG 2 cut(s) 145, 173
DdeI CTNAG 2 cut(s) 215, 330
Ecl136II GAGCTC 1 cut(s) 245
Eco24I GRGCYC 1 cut(s) 247
Eco47I GGWCC 2 cut(s) 61, 151
Eco53kI GAGCTC 1 cut(s) 245
EcoICRI GAGCTC 1 cut(s) 245
EcoO109I RGGNCCY 1 cut(s) 311
EcoRII CCWGG 1 cut(s) 162
EcoT38I GRGCYC 1 cut(s) 247
FaeI CATG 2 cut(s) 148, 176
FaiI YATR 6 cut(s) 114, 146, 174, 231, 258, 288
FatI CATG 2 cut(s) 144, 172
FokI GGATG 2 cut(s) 113, 141
FriOI GRGCYC 1 cut(s) 247
GsuI CTGGAG 2 cut(s) 146, 261
HaeIII GGCC 2 cut(s) 234, 313
HapII CCGG 2 cut(s) 6, 182
Hin1II CATG 2 cut(s) 148, 176
HinfI GANTC 1 cut(s) 332
HpaII CCGG 2 cut(s) 6, 182
HphI GGTGA 1 cut(s) 183
Hpy188III TCNNGA 2 cut(s) 197, 240
HpyAV CCTTC 1 cut(s) 33
HpyCH4V TGCA 5 cut(s) 48, 116, 207, 308, 339
HpyF3I CTNAG 2 cut(s) 215, 330
Hsp92II CATG 2 cut(s) 148, 176
LmnI GCTCC 2 cut(s) 242, 250
LpnPI CCDG 8 cut(s) 19, 149, 176, 193, 195, 225, 294, 342
MboII GAAGA 3 cut(s) 180, 212, 272
MhlI GDGCHC 1 cut(s) 247
MlyI GAGTC 1 cut(s) 341
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 3 cut(s) 170, 204, 245
MslI CAYNNNNRTG 1 cut(s) 123
MspI CCGG 2 cut(s) 6, 182
MspR9I CCNGG 2 cut(s) 7, 164
MvaI CCWGG 1 cut(s) 164
NciI CCSGG 1 cut(s) 7
NlaIII CATG 2 cut(s) 148, 176
NspI RCATGY 1 cut(s) 148
PciI ACATGT 1 cut(s) 144
PflFI GACNNNGTC 1 cut(s) 65
PflMI CCANNNNNTGG 1 cut(s) 148
PleI GAGTC 1 cut(s) 340
PpsI GAGTC 1 cut(s) 340
PscI ACATGT 1 cut(s) 144
Psp124BI GAGCTC 1 cut(s) 247
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
PspPI GGNCC 3 cut(s) 61, 151, 311
PstI CTGCAG 2 cut(s) 209, 310
PsyI GACNNNGTC 1 cut(s) 65
RseI CAYNNNNRTG 1 cut(s) 123
SacI GAGCTC 1 cut(s) 247
Sau96I GGNCC 3 cut(s) 61, 151, 311
SchI GAGTC 1 cut(s) 341
ScrFI CCNGG 2 cut(s) 7, 164
SduI GDGCHC 1 cut(s) 247
SetI ASST 6 cut(s) 74, 123, 196, 212, 247, 295
SfcI CTRYAG 2 cut(s) 205, 306
SinI GGWCC 2 cut(s) 61, 151
SmiMI CAYNNNNRTG 1 cut(s) 123
SsiI CCGC 1 cut(s) 98
SstI GAGCTC 1 cut(s) 247
StyD4I CCNGG 2 cut(s) 5, 162
TaqI TCGA 1 cut(s) 198
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 3 cut(s) 152, 273, 303
TspRI CASTG 1 cut(s) 43
Tth111I GACNNNGTC 1 cut(s) 65
Van91I CCANNNNNTGG 1 cut(s) 148
VpaK11BI GGWCC 2 cut(s) 61, 151
XceI RCATGY 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.