Rh1BG086900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
13755399 .. 13784829
29431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG086900.1

Sequence Viewer

Length: 228 bp
ATGAACCATGACTGCTGGGAGCTAATGGATTTGAGGTATGAAATGCAGAGGGCAACCTCTTTTGTTGCTCAACGCATCAATTTATGCAGAACTGGCAAAGTGATATCAGAACAAGCCAAAAAATTTCAGAGAAGAAGTGAAGGACCCAAAGCGTGTGTCACCAAGAGCTACAACAGACGACTAGTATTATTGAACTTCCATTGGCGATATCATCTTTTGGAGCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

9.14

Weight (kDa)

9.85

Isoelectric Point (pI)

38.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 122
AgsI TTSAA 1 cut(s) 193
AhlI ACTAGT 1 cut(s) 181
AluBI AGCT 2 cut(s) 22, 168
AluI AGCT 2 cut(s) 22, 168
ApoI RAATTY 1 cut(s) 122
ArsI GACNNNNNNTTYG 2 cut(s) 141, 173
AspS9I GGNCC 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 151
AvaII GGWCC 1 cut(s) 143
BcuI ACTAGT 1 cut(s) 181
BfaI CTAG 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 145
BmsI GCATC 1 cut(s) 84
Bse1I ACTGG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 97
BseYI CCCAGC 1 cut(s) 15
BspLI GGNNCC 1 cut(s) 145
BsrI ACTGG 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 143
CviAII CATG 1 cut(s) 8
CviJI RGCY 3 cut(s) 22, 116, 168
CviKI_1 RGCY 3 cut(s) 22, 116, 168
Eco32I GATATC 2 cut(s) 105, 209
Eco47I GGWCC 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 143
EcoRV GATATC 2 cut(s) 105, 209
FaeI CATG 1 cut(s) 11
FaiI YATR 3 cut(s) 9, 39, 85
FatI CATG 1 cut(s) 7
FspBI CTAG 1 cut(s) 182
GsaI CCCAGC 1 cut(s) 19
Hin1II CATG 1 cut(s) 11
HphI GGTGA 1 cut(s) 151
Hpy188I TCNGA 2 cut(s) 109, 129
HpyAV CCTTC 1 cut(s) 134
HpyCH4V TGCA 2 cut(s) 46, 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 93
Hsp92II CATG 1 cut(s) 11
LmnI GCTCC 2 cut(s) 19, 220
LpnPI CCDG 1 cut(s) 78
LweI GCATC 1 cut(s) 84
MaeI CTAG 1 cut(s) 182
MaeIII GTNAC 1 cut(s) 157
MboII GAAGA 1 cut(s) 144
MluCI AATT 2 cut(s) 79, 122
MnlI CCTC 3 cut(s) 27, 42, 67
MwoI GCNNNNNNNGC 1 cut(s) 93
NlaIII CATG 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 145
NmuCI GTSAC 1 cut(s) 157
PpuMI RGGWCCY 1 cut(s) 143
Psp5II RGGWCCY 1 cut(s) 143
PspFI CCCAGC 1 cut(s) 15
PspN4I GGNNCC 1 cut(s) 145
PspPI GGNCC 1 cut(s) 143
PspPPI RGGWCCY 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 143
SetI ASST 4 cut(s) 24, 38, 59, 170
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 7 cut(s) 20, 28, 105, 125, 165, 175, 194
SinI GGWCC 1 cut(s) 143
SpeI ACTAGT 1 cut(s) 181
Sse9I AATT 2 cut(s) 79, 122
SspMI CTAG 1 cut(s) 182
TasI AATT 2 cut(s) 79, 122
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 17, 54
VpaK11BI GGWCC 1 cut(s) 143
XapI RAATTY 1 cut(s) 122
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.