Rh3CG367200

Dehydrodolichyl diphosphate syntase complex subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
46406123 .. 46410582
4460 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG367200.1

Sequence Viewer

Length: 336 bp
ATGCTGATGGATTTGAGGTATGAAATGCAGAGGGCAACCTCTTTTGTTGCTCAAACTGGCAATCCTAGGCTTCTGCTACTCTGGCATATTCCGCATCTTTTTGTAATATCTACTCTGGCAATTGTAGTAGAAAGTGAAGACACATGGGAAATCTCCAAAATTATGGCGCTTCTTCTATGGGTAGAAGCTATTGGTGTGAAGAATGTGTGCTTCTATGACGCAGAAGGAGTGTTGAAGAAATTAAAAGAAGTCACCTTGAAGAAACTGAAAAGATTGCAAGAATTATACGGAACAATGGCTGTCCTCTCTTTAAAACTTTATGCCTCAGTTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.71

Weight (kDa)

8.73

Isoelectric Point (pI)

27.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AgsI TTSAA 2 cut(s) 235, 259
AluBI AGCT 2 cut(s) 188, 333
AluI AGCT 2 cut(s) 188, 333
AspA2I CCTAGG 1 cut(s) 65
AspLEI GCGC 1 cut(s) 169
AsuHPI GGTGA 1 cut(s) 244
AvrII CCTAGG 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 144
BfaI CTAG 1 cut(s) 66
BfoI RGCGCY 1 cut(s) 170
BlnI CCTAGG 1 cut(s) 65
BmsI GCATC 1 cut(s) 103
BpiI GAAGAC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 61
BspACI CCGC 1 cut(s) 92
BsrI ACTGG 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 65
BssT1I CCWWGG 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 325
BstH2I RGCGCY 1 cut(s) 170
BstHHI GCGC 1 cut(s) 169
BstMWI GCNNNNNNNGC 2 cut(s) 82, 91
BstV2I GAAGAC 1 cut(s) 144
BstXI CCANNNNNNTGG 1 cut(s) 163
CfoI GCGC 1 cut(s) 169
CseI GACGC 1 cut(s) 227
CviAII CATG 1 cut(s) 144
CviJI RGCY 4 cut(s) 70, 188, 299, 333
CviKI_1 RGCY 4 cut(s) 70, 188, 299, 333
DdeI CTNAG 1 cut(s) 325
DraI TTTAAA 1 cut(s) 312
Eco130I CCWWGG 1 cut(s) 65
EcoT14I CCWWGG 1 cut(s) 65
ErhI CCWWGG 1 cut(s) 65
FaeI CATG 1 cut(s) 147
FaiI YATR 8 cut(s) 21, 87, 145, 164, 178, 216, 286, 321
FatI CATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 66
GlaI GCGC 1 cut(s) 168
HaeII RGCGCY 1 cut(s) 170
HgaI GACGC 1 cut(s) 227
HhaI GCGC 1 cut(s) 169
Hin1II CATG 1 cut(s) 147
Hin6I GCGC 1 cut(s) 167
HinP1I GCGC 1 cut(s) 167
HphI GGTGA 1 cut(s) 244
HpyAV CCTTC 1 cut(s) 218
HpyCH4V TGCA 2 cut(s) 28, 277
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 91
HpyF3I CTNAG 1 cut(s) 325
Hsp92II CATG 1 cut(s) 147
HspAI GCGC 1 cut(s) 167
LpnPI CCDG 3 cut(s) 42, 67, 101
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 250
MboII GAAGA 5 cut(s) 149, 164, 211, 247, 271
MfeI CAATTG 1 cut(s) 120
MluCI AATT 4 cut(s) 120, 159, 239, 281
MnlI CCTC 5 cut(s) 9, 24, 49, 314, 334
MseI TTAA 2 cut(s) 242, 311
MunI CAATTG 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 82, 91
NlaIII CATG 1 cut(s) 147
NmuCI GTSAC 1 cut(s) 250
SaqAI TTAA 2 cut(s) 242, 311
SetI ASST 5 cut(s) 20, 41, 190, 257, 335
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 7 cut(s) 69, 78, 94, 128, 156, 268, 290
Sse9I AATT 4 cut(s) 120, 159, 239, 281
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 66
StyI CCWWGG 1 cut(s) 65
TasI AATT 4 cut(s) 120, 159, 239, 281
Tru1I TTAA 2 cut(s) 242, 311
Tru9I TTAA 2 cut(s) 242, 311
TseFI GTSAC 1 cut(s) 250
Tsp45I GTSAC 1 cut(s) 250
TspDTI ATGAA 1 cut(s) 36
TspGWI ACGGA 1 cut(s) 303
XmaJI CCTAGG 1 cut(s) 65
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.