Rh1CG232700

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0013781
Physical Location & Seq
Forward (+)
48935338 .. 48935688
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG232700.1

Sequence Viewer

Length: 237 bp
ATGGATAAAGAGTGGGTGTGTCTTCCCAGATCTAGTTCAGAGTATGAGCAAAGAGCATTACATTTTGTGAAGACGGCTGAAAAGAATTTGGGATATCCTGCAATGATTCTTTGCCCTTGCAAAGATTGCCGTAATGTAAGCCATCAAGATAGTACTACTGTTTTTGAACATTTGGTTATAAAGGGGATGGATTCCAAGTACAAGAAAAGATCACATTGGACAAAACATGGAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21

Protein Analysis

78

Amino Acids

9.13

Weight (kDa)

8.73

Isoelectric Point (pI)

41.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transpos_assoc PF13963 3 - 77 1.2e-17 Transposase-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 179
AcsI RAATTY 1 cut(s) 85
AfaI GTAC 2 cut(s) 154, 200
AgsI TTSAA 1 cut(s) 167
ApoI RAATTY 1 cut(s) 85
BbsI GAAGAC 2 cut(s) 14, 77
BccI CCATC 2 cut(s) 150, 181
BceAI ACGGC 2 cut(s) 90, 114
BfaI CTAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 29
BmcAI AGTACT 1 cut(s) 154
BpiI GAAGAC 2 cut(s) 14, 77
Bse3DI GCAATG 1 cut(s) 108
BseGI GGATG 1 cut(s) 192
BseMI GCAATG 1 cut(s) 108
Bsp143I GATC 2 cut(s) 29, 209
BsrDI GCAATG 1 cut(s) 108
BssMI GATC 2 cut(s) 29, 209
Bst4CI ACNGT 1 cut(s) 160
BstAPI GCANNNNNTGC 1 cut(s) 126
BstF5I GGATG 1 cut(s) 192
BstKTI GATC 2 cut(s) 32, 212
BstMBI GATC 2 cut(s) 29, 209
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstV2I GAAGAC 2 cut(s) 14, 77
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
BtsCI GGATG 1 cut(s) 192
Csp6I GTAC 2 cut(s) 153, 199
CviAII CATG 1 cut(s) 227
CviJI RGCY 2 cut(s) 77, 141
CviKI_1 RGCY 2 cut(s) 77, 141
CviQI GTAC 2 cut(s) 153, 199
DpnI GATC 2 cut(s) 31, 211
DpnII GATC 2 cut(s) 29, 209
Eco32I GATATC 1 cut(s) 95
EcoRV GATATC 1 cut(s) 95
FaeI CATG 1 cut(s) 230
FaiI YATR 3 cut(s) 45, 179, 228
FatI CATG 1 cut(s) 226
FokI GGATG 1 cut(s) 199
FspBI CTAG 1 cut(s) 33
Hin1II CATG 1 cut(s) 230
HinfI GANTC 2 cut(s) 106, 191
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 101, 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
Hsp92II CATG 1 cut(s) 230
Kzo9I GATC 2 cut(s) 29, 209
LpnPI CCDG 2 cut(s) 40, 111
MaeI CTAG 1 cut(s) 33
MalI GATC 2 cut(s) 31, 211
MboI GATC 2 cut(s) 29, 209
MboII GAAGA 2 cut(s) 14, 82
MflI RGATCY 1 cut(s) 29
MluCI AATT 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 2 cut(s) 29, 209
NlaIII CATG 1 cut(s) 230
PfeI GAWTC 2 cut(s) 106, 191
PsiI TTATAA 1 cut(s) 179
PsuI RGATCY 1 cut(s) 29
RsaI GTAC 2 cut(s) 154, 200
RsaNI GTAC 2 cut(s) 153, 199
Sau3AI GATC 2 cut(s) 29, 209
ScaI AGTACT 1 cut(s) 154
SgeI CNNG 7 cut(s) 39, 45, 110, 129, 158, 208, 214
Sse9I AATT 1 cut(s) 85
SspMI CTAG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 160
TasI AATT 1 cut(s) 85
TatI WGTACW 2 cut(s) 152, 198
TfiI GAWTC 2 cut(s) 106, 191
XapI RAATTY 1 cut(s) 85
XspI CTAG 1 cut(s) 33
ZrmI AGTACT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.