Rh6DG120700

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
16607992 .. 16610997
3006 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG120700.1

Sequence Viewer

Length: 588 bp
ATGTTCCCTTTTGAAAGGTATATGAAGGTCTTAAAGGATTATGTTAAAAACCTTTTAAACCCAAAAGGATGTATAGCAAAGAAGTATCTAGCTGAAGAGATAACATGCTTTTGTGATGGGTACATCAAAGAAGCTGTTGAAATAGGTGTTCAACATAAACGTAACAAAAATTGGGAAGATAAAACTATATTAGAAGGGAAGCCTATTGGTCTGAAGAAGTTAAGACAGTTGACTCCTACTATGTGGGAGATTGCTCATCAGTATGTATTGACAAATACTACAGAGCTTGATCTATGGAAAGAGTTACATAAACATGAGCTTAAGCTCATTGATAAGCGTCTTGAAAAGAACACAAGTCTTCTCCAAACAAAACATCAGAGGACTTTTAGTGATTGGCTGGCAGATAAAGTTAGAACCAGCGATTGTAGTATTATGTCGGATACTATAAGGTGGATTGCATGTAAGCCAAAATGGGAAGTTTTGTCATGTTCAAGCTACCTTATTAACAGGAACCGATTTCACACTAGGGAGTCTGAAACAGGGACACAAAACTATGGTATTTCTGTTGAAACTAACACATATTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

195

Amino Acids

23.07

Weight (kDa)

8.98

Isoelectric Point (pI)

33.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4218 PF13960 1 - 55 3.5e-10 Domain of unknown function (DUF4218)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 114, 233
AfaI GTAC 1 cut(s) 122
AflII CTTAAG 1 cut(s) 320
AgsI TTSAA 6 cut(s) 14, 140, 152, 344, 492, 569
AluBI AGCT 6 cut(s) 92, 134, 286, 319, 325, 495
AluI AGCT 6 cut(s) 92, 134, 286, 319, 325, 495
BbsI GAAGAC 1 cut(s) 350
BccI CCATC 1 cut(s) 110
BciVI GTATCC 1 cut(s) 433
BfaI CTAG 2 cut(s) 89, 525
BfmI CTRYAG 1 cut(s) 279
BfrI CTTAAG 1 cut(s) 320
BfuI GTATCC 1 cut(s) 433
BmiI GGNNCC 1 cut(s) 512
BpiI GAAGAC 1 cut(s) 350
BseGI GGATG 1 cut(s) 74
BslFI GGGAC 1 cut(s) 556
BsmFI GGGAC 1 cut(s) 556
Bsp143I GATC 1 cut(s) 289
BspLI GGNNCC 1 cut(s) 512
BspTI CTTAAG 1 cut(s) 320
BssMI GATC 1 cut(s) 289
Bst4CI ACNGT 1 cut(s) 228
Bst6I CTCTTC 1 cut(s) 90
BstAFI CTTAAG 1 cut(s) 320
BstC8I GCNNGC 1 cut(s) 399
BstF5I GGATG 1 cut(s) 74
BstKTI GATC 1 cut(s) 292
BstMBI GATC 1 cut(s) 289
BstNSI RCATGY 2 cut(s) 108, 462
BstSFI CTRYAG 1 cut(s) 279
BstV2I GAAGAC 1 cut(s) 350
BsuI GTATCC 1 cut(s) 433
BtsCI GGATG 1 cut(s) 74
Cac8I GCNNGC 1 cut(s) 399
CseI GACGC 1 cut(s) 326
Csp6I GTAC 1 cut(s) 121
CviAII CATG 4 cut(s) 105, 314, 459, 486
CviJI RGCY 9 cut(s) 92, 134, 202, 286, 319, 325, 397, 466, 495
CviKI_1 RGCY 9 cut(s) 92, 134, 202, 286, 319, 325, 397, 466, 495
CviQI GTAC 1 cut(s) 121
DpnI GATC 1 cut(s) 291
DpnII GATC 1 cut(s) 289
DraI TTTAAA 1 cut(s) 57
Eam1104I CTCTTC 1 cut(s) 90
EarI CTCTTC 1 cut(s) 90
Eco57I CTGAAG 2 cut(s) 114, 233
FaeI CATG 4 cut(s) 108, 317, 462, 489
FaqI GGGAC 1 cut(s) 556
FatI CATG 4 cut(s) 104, 313, 458, 485
FokI GGATG 1 cut(s) 81
FspBI CTAG 2 cut(s) 89, 525
HgaI GACGC 1 cut(s) 326
Hin1II CATG 4 cut(s) 108, 317, 462, 489
HincII GTYRAC 1 cut(s) 231
HindII GTYRAC 1 cut(s) 231
HinfI GANTC 2 cut(s) 232, 530
Hpy166II GTNNAC 1 cut(s) 231
Hpy188I TCNGA 4 cut(s) 213, 378, 439, 535
Hpy188III TCNNGA 1 cut(s) 341
Hpy8I GTNNAC 1 cut(s) 231
HpyAV CCTTC 2 cut(s) 19, 188
HpyCH4III ACNGT 1 cut(s) 228
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 458
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 4 cut(s) 108, 317, 462, 489
Kzo9I GATC 1 cut(s) 289
LpnPI CCDG 4 cut(s) 383, 430, 493, 525
MaeI CTAG 2 cut(s) 89, 525
MaeII ACGT 1 cut(s) 160
MaeIII GTNAC 2 cut(s) 161, 303
MalI GATC 1 cut(s) 291
MboI GATC 1 cut(s) 289
MboII GAAGA 4 cut(s) 107, 188, 226, 350
MluCI AATT 1 cut(s) 169
MlyI GAGTC 2 cut(s) 226, 539
MmeI TCCRAC 1 cut(s) 417
MnlI CCTC 1 cut(s) 372
MseI TTAA 6 cut(s) 32, 45, 56, 221, 321, 504
MslI CAYNNNNRTG 2 cut(s) 261, 312
MspCI CTTAAG 1 cut(s) 320
NdeII GATC 1 cut(s) 289
NlaIII CATG 4 cut(s) 108, 317, 462, 489
NlaIV GGNNCC 1 cut(s) 512
NspI RCATGY 2 cut(s) 108, 462
PleI GAGTC 2 cut(s) 226, 538
PpsI GAGTC 2 cut(s) 226, 538
PspN4I GGNNCC 1 cut(s) 512
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
RseI CAYNNNNRTG 2 cut(s) 261, 312
SaqAI TTAA 6 cut(s) 32, 45, 56, 221, 321, 504
Sau3AI GATC 1 cut(s) 289
SchI GAGTC 2 cut(s) 226, 539
SfcI CTRYAG 1 cut(s) 279
SmiMI CAYNNNNRTG 2 cut(s) 261, 312
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
Sse9I AATT 1 cut(s) 169
SspMI CTAG 2 cut(s) 89, 525
TaaI ACNGT 1 cut(s) 228
TaiI ACGT 1 cut(s) 163
TasI AATT 1 cut(s) 169
Tru1I TTAA 6 cut(s) 32, 45, 56, 221, 321, 504
Tru9I TTAA 6 cut(s) 32, 45, 56, 221, 321, 504
TspDTI ATGAA 1 cut(s) 38
Vha464I CTTAAG 1 cut(s) 320
XceI RCATGY 2 cut(s) 108, 462
XspI CTAG 2 cut(s) 89, 525
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.