Rh6BG053100

Domain of unknown function (DUF4218)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
8706313 .. 8706685
373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG053100.1

Sequence Viewer

Length: 282 bp
ATGGGCCATAGGAAATTTCTGTCACCTGCACATTCATATCGGGGAAAAAAGGCCTGGTTTGACAACAATGTGGAACATGGAAGGAAGCCAAGAATCTTGACAGGTCGGAATATTTCAGTTGCTCTTAGAAATTTTCCAAATGATTTTGGAAAAGGTAGTAACAAAAAAAGAAAAAGGAATGACAATGCTGATCCATATTCTAATGGTGAAGACAATGATGATGTTAATGATGACTATGATGATCAGGAGGAGCTATCAAGAGTGTCAAATGATAATTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.79

Weight (kDa)

8.0

Isoelectric Point (pI)

38.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 34
Acc36I ACCTGC 1 cut(s) 34
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 2 cut(s) 14, 130
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 1 cut(s) 253
AluI AGCT 1 cut(s) 253
AlwI GGATC 1 cut(s) 185
AoxI GGCC 2 cut(s) 4, 51
ApoI RAATTY 2 cut(s) 14, 130
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 15, 218
BbsI GAAGAC 1 cut(s) 216
BciT130I CCWGG 1 cut(s) 55
BclI TGATCA 1 cut(s) 241
BfuAI ACCTGC 1 cut(s) 34
Bme1390I CCNGG 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 55
BpiI GAAGAC 1 cut(s) 216
BseBI CCWGG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 263
BsgI GTGCAG 1 cut(s) 12
BshFI GGCC 2 cut(s) 6, 53
BsnI GGCC 2 cut(s) 6, 53
Bsp143I GATC 2 cut(s) 190, 241
BspANI GGCC 2 cut(s) 6, 53
BspMI ACCTGC 1 cut(s) 34
BspPI GGATC 1 cut(s) 185
BssMI GATC 2 cut(s) 190, 241
Bst2UI CCWGG 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 125
BstKTI GATC 2 cut(s) 193, 244
BstMBI GATC 2 cut(s) 190, 241
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstV2I GAAGAC 1 cut(s) 216
BsuRI GGCC 2 cut(s) 6, 53
BveI ACCTGC 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 77
CviJI RGCY 4 cut(s) 6, 53, 88, 253
CviKI_1 RGCY 4 cut(s) 6, 53, 88, 253
DdeI CTNAG 1 cut(s) 125
DpnI GATC 2 cut(s) 192, 243
DpnII GATC 2 cut(s) 190, 241
Eco147I AGGCCT 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 53
FaeI CATG 1 cut(s) 80
FaiI YATR 5 cut(s) 9, 37, 78, 196, 237
FatI CATG 1 cut(s) 76
FbaI TGATCA 1 cut(s) 241
HaeIII GGCC 2 cut(s) 6, 53
Hin1II CATG 1 cut(s) 80
HinfI GANTC 1 cut(s) 93
HphI GGTGA 2 cut(s) 15, 218
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 3 cut(s) 97, 245, 258
HpyAV CCTTC 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 80
Ksp22I TGATCA 1 cut(s) 241
Kzo9I GATC 2 cut(s) 190, 241
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 5 cut(s) 39, 40, 67, 87, 230
MaeIII GTNAC 2 cut(s) 21, 158
MalI GATC 2 cut(s) 192, 243
MboI GATC 2 cut(s) 190, 241
MboII GAAGA 1 cut(s) 221
MluCI AATT 3 cut(s) 14, 130, 274
MmeI TCCRAC 1 cut(s) 86
MnlI CCTC 1 cut(s) 241
MseI TTAA 1 cut(s) 225
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
NdeII GATC 2 cut(s) 190, 241
NlaIII CATG 1 cut(s) 80
NmuCI GTSAC 1 cut(s) 21
PaqCI CACCTGC 1 cut(s) 34
PceI AGGCCT 1 cut(s) 53
PfeI GAWTC 1 cut(s) 93
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 225
Sau3AI GATC 2 cut(s) 190, 241
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 55
SetI ASST 4 cut(s) 28, 106, 157, 255
Sse9I AATT 3 cut(s) 14, 130, 274
SseBI AGGCCT 1 cut(s) 53
SspI AATATT 1 cut(s) 112
StuI AGGCCT 1 cut(s) 53
StyD4I CCNGG 1 cut(s) 53
TasI AATT 3 cut(s) 14, 130, 274
TfiI GAWTC 1 cut(s) 93
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseFI GTSAC 1 cut(s) 21
Tsp45I GTSAC 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 24
XapI RAATTY 2 cut(s) 14, 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.