Rh2CG372200
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
50509409 .. 50520496
11088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG372200.1

Sequence Viewer

Length: 567 bp
ATGTCTGTCAGAGAAGGAGAAAAAGATGTGCATAGACTGATTCATAAAAATAGCAATAAATTAACCAATAACGGGAATGATAGTAGAGGGCTGGATGTTCCTTCATCACTAGCTGTGACTGCAGATAAAACTGATGGTACAGTTGCTCTGGTGAAATCAGGTCCTGAGAAAGTTAAAACTACCCCTGCAGGAGAATATCTTAATTCTGCCTTGAATGATTTTGACCCTGAACAACATGACAGTCTTGCTGCCATTTCAGATGGTGCAAACAAACTTTTGATGCTGGTTCTGGCTGCAGTAATTAAAGCTTGGGCTTCTAGGGAGCATGAAATACTTGCTGAAATAAGAGATGTTGTTTTCTCTTTTATTCGTAAAATGGAACCGCAGAGGGTAATGGACACCATGCTTGTATCCCGTGTTAGAATTTTGTATATTACATCTTTGCTTGCTAGATCACCAGAGCTGCAGTCCATCAAGGTTTCTCCCATTGAGAATTTTCTAGAGAAGGTAATACTGGACGTAGTAGAAGCTCCAGTCGGGGTAGCAGCCCTGGAAGAAGTCCTGTGA

Protein Analysis

188

Amino Acids

20.61

Weight (kDa)

5.43

Isoelectric Point (pI)

43.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 383
AcsI RAATTY 2 cut(s) 423, 493
AfaI GTAC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 1 cut(s) 214
AjnI CCWGG 1 cut(s) 549
AluBI AGCT 4 cut(s) 113, 308, 463, 530
AluI AGCT 4 cut(s) 113, 308, 463, 530
AlwNI CAGNNNCTG 1 cut(s) 164
ApeKI GCWGC 4 cut(s) 248, 293, 463, 545
ApoI RAATTY 2 cut(s) 423, 493
AspS9I GGNCC 1 cut(s) 161
AsuHPI GGTGA 2 cut(s) 163, 447
AvaII GGWCC 1 cut(s) 161
BbvI GCAGC 4 cut(s) 235, 280, 450, 557
BccI CCATC 3 cut(s) 128, 254, 479
BciT130I CCWGG 1 cut(s) 551
BciVI GTATCC 1 cut(s) 421
BfaI CTAG 4 cut(s) 110, 318, 450, 500
BfmI CTRYAG 4 cut(s) 120, 186, 294, 464
BfuI GTATCC 1 cut(s) 421
BisI GCNGC 4 cut(s) 249, 294, 464, 546
BlsI GCNGC 4 cut(s) 250, 295, 465, 547
Bme1390I CCNGG 1 cut(s) 551
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 1 cut(s) 381
BmrFI CCNGG 1 cut(s) 551
BmsI GCATC 1 cut(s) 270
BpmI CTGGAG 1 cut(s) 516
BsaJI CCNNGG 1 cut(s) 549
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse1I ACTGG 2 cut(s) 519, 533
BseBI CCWGG 1 cut(s) 551
BseDI CCNNGG 1 cut(s) 549
BseGI GGATG 1 cut(s) 100
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 156
BseNI ACTGG 2 cut(s) 519, 533
BseXI GCAGC 4 cut(s) 235, 280, 450, 557
BslI CCNNNNNNNGG 1 cut(s) 72
Bsp143I GATC 1 cut(s) 452
BspACI CCGC 1 cut(s) 383
BspCNI CTCAG 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 381
BspMAI CTGCAG 4 cut(s) 124, 190, 298, 468
BsrI ACTGG 2 cut(s) 519, 533
BssECI CCNNGG 1 cut(s) 549
BssMI GATC 1 cut(s) 452
Bst2UI CCWGG 1 cut(s) 551
Bst4CI ACNGT 2 cut(s) 142, 242
BstC8I GCNNGC 1 cut(s) 447
BstDEI CTNAG 1 cut(s) 165
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 1 cut(s) 455
BstMBI GATC 1 cut(s) 452
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstNI CCWGG 1 cut(s) 551
BstSCI CCNGG 1 cut(s) 549
BstSFI CTRYAG 4 cut(s) 120, 186, 294, 464
BstV1I GCAGC 4 cut(s) 235, 280, 450, 557
BsuI GTATCC 1 cut(s) 421
BtsCI GGATG 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 447
CaiI CAGNNNCTG 1 cut(s) 164
Cfr13I GGNCC 1 cut(s) 161
Csp6I GTAC 1 cut(s) 138
CviAII CATG 3 cut(s) 236, 326, 403
CviJI RGCY 8 cut(s) 91, 113, 293, 308, 314, 463, 530, 548
CviKI_1 RGCY 8 cut(s) 91, 113, 293, 308, 314, 463, 530, 548
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 1 cut(s) 165
DpnI GATC 1 cut(s) 454
DpnII GATC 1 cut(s) 452
Eco47I GGWCC 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 549
FaeI CATG 3 cut(s) 239, 329, 406
FaiI YATR 6 cut(s) 33, 45, 237, 327, 404, 432
FatI CATG 3 cut(s) 235, 325, 402
Fnu4HI GCNGC 4 cut(s) 249, 294, 464, 546
FokI GGATG 1 cut(s) 107
Fsp4HI GCNGC 4 cut(s) 249, 294, 464, 546
FspBI CTAG 4 cut(s) 110, 318, 450, 500
GluI GCNGC 4 cut(s) 249, 294, 464, 546
GsuI CTGGAG 1 cut(s) 516
Hin1II CATG 3 cut(s) 239, 329, 406
HindIII AAGCTT 1 cut(s) 306
HinfI GANTC 1 cut(s) 40
HphI GGTGA 2 cut(s) 163, 447
Hpy188I TCNGA 2 cut(s) 11, 259
Hpy188III TCNNGA 2 cut(s) 164, 500
HpyAV CCTTC 3 cut(s) 8, 111, 499
HpyCH4III ACNGT 2 cut(s) 142, 242
HpyCH4IV ACGT 1 cut(s) 519
HpyCH4V TGCA 6 cut(s) 31, 122, 188, 266, 296, 466
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 1 cut(s) 165
HpySE526I ACGT 1 cut(s) 519
Hsp92II CATG 3 cut(s) 239, 329, 406
Kzo9I GATC 1 cut(s) 452
LmnI GCTCC 2 cut(s) 322, 535
Lsp1109I GCAGC 4 cut(s) 235, 280, 450, 557
LweI GCATC 1 cut(s) 270
MaeI CTAG 4 cut(s) 110, 318, 450, 500
MaeII ACGT 1 cut(s) 519
MaeIII GTNAC 1 cut(s) 115
MalI GATC 1 cut(s) 454
MboI GATC 1 cut(s) 452
MboII GAAGA 1 cut(s) 566
MluCI AATT 5 cut(s) 59, 202, 300, 423, 493
MnlI CCTC 2 cut(s) 80, 381
MseI TTAA 4 cut(s) 62, 174, 201, 303
MspR9I CCNGG 1 cut(s) 551
MvaI CCWGG 1 cut(s) 551
MwoI GCNNNNNNNGC 1 cut(s) 119
NdeII GATC 1 cut(s) 452
NlaIII CATG 3 cut(s) 239, 329, 406
NlaIV GGNNCC 1 cut(s) 381
NmuCI GTSAC 1 cut(s) 115
PfeI GAWTC 1 cut(s) 40
PkrI GCNGC 4 cut(s) 250, 295, 465, 547
PpuMI RGGWCCY 1 cut(s) 161
Psp5II RGGWCCY 1 cut(s) 161
Psp6I CCWGG 1 cut(s) 549
PspGI CCWGG 1 cut(s) 549
PspN4I GGNNCC 1 cut(s) 381
PspPI GGNCC 1 cut(s) 161
PspPPI RGGWCCY 1 cut(s) 161
PstI CTGCAG 4 cut(s) 124, 190, 298, 468
PstNI CAGNNNCTG 1 cut(s) 164
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 4 cut(s) 62, 174, 201, 303
SatI GCNGC 4 cut(s) 249, 294, 464, 546
Sau3AI GATC 1 cut(s) 452
Sau96I GGNCC 1 cut(s) 161
SbfI CCTGCAGG 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 551
SdaI CCTGCAGG 1 cut(s) 190
SetI ASST 8 cut(s) 115, 163, 310, 465, 480, 510, 522, 532
SfaNI GCATC 1 cut(s) 270
SfcI CTRYAG 4 cut(s) 120, 186, 294, 464
SinI GGWCC 1 cut(s) 161
Sse8387I CCTGCAGG 1 cut(s) 190
Sse9I AATT 5 cut(s) 59, 202, 300, 423, 493
SsiI CCGC 1 cut(s) 383
SspMI CTAG 4 cut(s) 110, 318, 450, 500
StyD4I CCNGG 1 cut(s) 549
TaaI ACNGT 2 cut(s) 142, 242
TaiI ACGT 1 cut(s) 522
TasI AATT 5 cut(s) 59, 202, 300, 423, 493
TfiI GAWTC 1 cut(s) 40
Tru1I TTAA 4 cut(s) 62, 174, 201, 303
Tru9I TTAA 4 cut(s) 62, 174, 201, 303
TseFI GTSAC 1 cut(s) 115
TseI GCWGC 4 cut(s) 248, 293, 463, 545
Tsp45I GTSAC 1 cut(s) 115
TspDTI ATGAA 3 cut(s) 32, 93, 342
VpaK11BI GGWCC 1 cut(s) 161
XapI RAATTY 2 cut(s) 423, 493
XbaI TCTAGA 1 cut(s) 499
XspI CTAG 4 cut(s) 110, 318, 450, 500
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.