Rh5DG281100

1-deoxy-D-xylulose 5-phosphate reductoisomerase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
34486891 .. 34492984
6094 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG281100.1

Sequence Viewer

Length: 201 bp
ATGGTCCAAAAGCCTAGTTCTGTTGTTGGATCTACTGGTTCCATTGGAACCCAGACATTGGACATTGTTGCAGAGAACCCGAAAAAATTCAGAGTAGTGGCCCTAGTAGCTGGCTCAAATGTGTATCTTCTTGTTGATCAGCCTTGTGCTTATACCAAACCCAAAGTCCAATCAACATCCCTCATTATTTTACTCAAATAG

Protein Analysis

66

Amino Acids

7.0

Weight (kDa)

9.58

Isoelectric Point (pI)

10.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DXP_reductoisom PF02670 7 - 56 2.4e-14 1-deoxy-D-xylulose 5-phosphate reductoisomerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 58
AclWI GGATC 1 cut(s) 37
AcsI RAATTY 1 cut(s) 86
AfiI CCNNNNNNNGG 1 cut(s) 58
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AlwI GGATC 1 cut(s) 37
AoxI GGCC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 86
ArsI GACNNNNNNTTYG 2 cut(s) 150, 182
Asp700I GAANNNNTTC 1 cut(s) 86
AspS9I GGNCC 2 cut(s) 4, 100
AvaII GGWCC 1 cut(s) 4
BclI TGATCA 1 cut(s) 136
BfaI CTAG 2 cut(s) 15, 104
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 100
BmiI GGNNCC 2 cut(s) 40, 49
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 40
BseGI GGATG 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 40
BshFI GGCC 1 cut(s) 101
BslI CCNNNNNNNGG 1 cut(s) 58
BsnI GGCC 1 cut(s) 101
Bsp143I GATC 2 cut(s) 29, 136
BspANI GGCC 1 cut(s) 101
BspLI GGNNCC 2 cut(s) 40, 49
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 40
BssMI GATC 2 cut(s) 29, 136
BstC8I GCNNGC 1 cut(s) 112
BstF5I GGATG 1 cut(s) 176
BstKTI GATC 2 cut(s) 32, 139
BstMBI GATC 2 cut(s) 29, 136
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
BsuRI GGCC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 176
Cac8I GCNNGC 1 cut(s) 112
Cfr13I GGNCC 2 cut(s) 4, 100
CviJI RGCY 5 cut(s) 13, 101, 110, 114, 142
CviKI_1 RGCY 5 cut(s) 13, 101, 110, 114, 142
DpnI GATC 2 cut(s) 31, 138
DpnII GATC 2 cut(s) 29, 136
Eco47I GGWCC 1 cut(s) 4
FaiI YATR 1 cut(s) 153
FbaI TGATCA 1 cut(s) 136
FokI GGATG 1 cut(s) 163
FspBI CTAG 2 cut(s) 15, 104
HaeIII GGCC 1 cut(s) 101
Hpy188I TCNGA 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Ksp22I TGATCA 1 cut(s) 136
Kzo9I GATC 2 cut(s) 29, 136
LpnPI CCDG 3 cut(s) 21, 65, 96
MaeI CTAG 2 cut(s) 15, 104
MalI GATC 2 cut(s) 31, 138
MboI GATC 2 cut(s) 29, 136
MboII GAAGA 1 cut(s) 119
MflI RGATCY 1 cut(s) 29
MluCI AATT 1 cut(s) 86
MmeI TCCRAC 1 cut(s) 7
MnlI CCTC 1 cut(s) 191
MroXI GAANNNNTTC 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 2 cut(s) 29, 136
NlaIV GGNNCC 2 cut(s) 40, 49
PdmI GAANNNNTTC 1 cut(s) 86
PflMI CCANNNNNTGG 1 cut(s) 58
PspN4I GGNNCC 2 cut(s) 40, 49
PspPI GGNCC 2 cut(s) 4, 100
PsuI RGATCY 1 cut(s) 29
Sau3AI GATC 2 cut(s) 29, 136
Sau96I GGNCC 2 cut(s) 4, 100
SetI ASST 1 cut(s) 112
SgeI CNNG 8 cut(s) 27, 48, 64, 91, 116, 123, 143, 156
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 86
SspMI CTAG 2 cut(s) 15, 104
TasI AATT 1 cut(s) 86
Van91I CCANNNNNTGG 1 cut(s) 58
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 86
XmnI GAANNNNTTC 1 cut(s) 86
XspI CTAG 2 cut(s) 15, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.