Rh2CG389900

Small nuclear RNA activating complex (SNAPc), subunit SNAP43

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0002506
Physical Location & Seq
Reverse (-)
53080017 .. 53080205
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG389900.1

Sequence Viewer

Length: 189 bp
ATGGATCTCGCTCCGATGAAGCGTGACATCGACGACTTGATATCCCAATTCGCTGCTGCCGATTCGACTCGCTTCACCGATATGAAGCAAGTCTGGCTCTCCAACAAGTTCTCCTACATCTACGACGTGCGTCCCACTTGCACCAATTCCCTCGCCCTCTTCATGCAATCACTCAGTCGGACACCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SNAPc_SNAP43

Protein Analysis

62

Amino Acids

7.15

Weight (kDa)

5.97

Isoelectric Point (pI)

47.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNAPC1 PF09808 6 - 58 6e-12 Small nuclear RNA activating complex (SNAPc), subunit 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AjiI CACGTC 1 cut(s) 127
AlwI GGATC 1 cut(s) 12
ApeKI GCWGC 2 cut(s) 53, 56
AsuHPI GGTGA 1 cut(s) 67
BbvI GCAGC 2 cut(s) 40, 43
BisI GCNGC 2 cut(s) 54, 57
BlsI GCNGC 2 cut(s) 55, 58
BmgBI CACGTC 1 cut(s) 127
BoxI GACNNNNGTC 1 cut(s) 129
BsaXI ACNNNNNCTCC 2 cut(s) 95, 125
BseMII CTCAG 1 cut(s) 187
BseXI GCAGC 2 cut(s) 40, 43
BslFI GGGAC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 4
BspCNI CTCAG 1 cut(s) 186
BspPI GGATC 1 cut(s) 12
BssMI GATC 1 cut(s) 4
Bst6I CTCTTC 1 cut(s) 164
BstDEI CTNAG 2 cut(s) 173, 186
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 1 cut(s) 94
BstPAI GACNNNNGTC 1 cut(s) 129
BstV1I GCAGC 2 cut(s) 40, 43
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtrI CACGTC 1 cut(s) 127
CseI GACGC 1 cut(s) 119
CviAII CATG 1 cut(s) 163
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
DdeI CTNAG 2 cut(s) 173, 186
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
Eco32I GATATC 1 cut(s) 42
EcoRV GATATC 1 cut(s) 42
FaeI CATG 1 cut(s) 166
FaiI YATR 2 cut(s) 83, 164
FaqI GGGAC 1 cut(s) 117
FatI CATG 1 cut(s) 162
Fnu4HI GCNGC 2 cut(s) 54, 57
Fsp4HI GCNGC 2 cut(s) 54, 57
GluI GCNGC 2 cut(s) 54, 57
HgaI GACGC 1 cut(s) 119
Hin1II CATG 1 cut(s) 166
HinfI GANTC 2 cut(s) 62, 67
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 15, 180
Hpy99I CGWCG 2 cut(s) 35, 128
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 141, 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 94
HpyF3I CTNAG 2 cut(s) 173, 186
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 1 cut(s) 166
Kzo9I GATC 1 cut(s) 4
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 79
Lsp1109I GCAGC 2 cut(s) 40, 43
MaeII ACGT 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 23
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MboII GAAGA 1 cut(s) 151
MflI RGATCY 1 cut(s) 4
MluCI AATT 2 cut(s) 47, 145
MlyI GAGTC 1 cut(s) 61
MmeI TCCRAC 2 cut(s) 126, 158
MnlI CCTC 2 cut(s) 161, 167
MslI CAYNNNNRTG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 94
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 23
PcsI WCGNNNNNNNCGW 1 cut(s) 57
PfeI GAWTC 1 cut(s) 62
PkrI GCNGC 2 cut(s) 55, 58
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
PshAI GACNNNNGTC 1 cut(s) 129
PsuI RGATCY 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 80
SatI GCNGC 2 cut(s) 54, 57
Sau3AI GATC 1 cut(s) 4
SchI GAGTC 1 cut(s) 61
SetI ASST 2 cut(s) 129, 187
SmiMI CAYNNNNRTG 1 cut(s) 80
Sse9I AATT 2 cut(s) 47, 145
TaiI ACGT 1 cut(s) 129
TaqI TCGA 2 cut(s) 30, 65
TasI AATT 2 cut(s) 47, 145
TfiI GAWTC 1 cut(s) 62
TseFI GTSAC 1 cut(s) 23
TseI GCWGC 2 cut(s) 53, 56
Tsp45I GTSAC 1 cut(s) 23
TspDTI ATGAA 3 cut(s) 32, 98, 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.