Rh2DG141000

EamA-like transporter family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0005515
Physical Location & Seq
Reverse (-)
11820243 .. 11820652
410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG141000.1

Sequence Viewer

Length: 318 bp
ATGGCGAATGTAATACAGATATGGGTGATTGACAAGGGAGGACCAGTGTATGTTTCACTGTATCTGCCTTTACAGACGGCAGTTGTAGCTGTAATGGACTCGCTCGTTTTTGGTGAAGAATTCTACTTGGGAAGCATTATTGGAGCAATGTTGACCATAGCAGGGCTGTACCTGGTGGTCTGGGGAAAAAGGCAGGAGAGCAAAATCAAGGTGGAAACTTCCTCAATGCCAGGGAACATTAACAGTCTGATAAACTATTGTTCTGGGGGAGAAGAACCCTCTCTTGTTCAAGCATTGCTCCCTACCTCTGCTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0008150 GO:0016020 GO:0022857 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EamA

Protein Analysis

105

Amino Acids

11.33

Weight (kDa)

4.6

Isoelectric Point (pI)

45.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EamA PF00892 3 - 60 5e-06 EamA-like transporter family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 119
AfaI GTAC 1 cut(s) 170
AfiI CCNNNNNNNGG 1 cut(s) 162
AgsI TTSAA 1 cut(s) 290
AjnI CCWGG 2 cut(s) 171, 229
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
ApoI RAATTY 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 41
AsuHPI GGTGA 2 cut(s) 37, 125
AvaII GGWCC 1 cut(s) 41
BceAI ACGGC 1 cut(s) 93
BciT130I CCWGG 2 cut(s) 173, 231
BfaI CTAG 1 cut(s) 316
Bme1390I CCNGG 2 cut(s) 173, 231
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 1 cut(s) 41
BmrFI CCNGG 2 cut(s) 173, 231
BsaJI CCNNGG 1 cut(s) 230
BsaXI ACNNNNNCTCC 2 cut(s) 30, 60
Bsc4I CCNNNNNNNGG 1 cut(s) 162
Bse1I ACTGG 1 cut(s) 44
Bse3DI GCAATG 2 cut(s) 153, 293
BseBI CCWGG 2 cut(s) 173, 231
BseDI CCNNGG 1 cut(s) 230
BseLI CCNNNNNNNGG 1 cut(s) 162
BseMI GCAATG 2 cut(s) 153, 293
BseNI ACTGG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 162
BsrDI GCAATG 2 cut(s) 153, 293
BsrI ACTGG 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 230
Bst2UI CCWGG 2 cut(s) 173, 231
Bst4CI ACNGT 2 cut(s) 60, 245
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 2 cut(s) 173, 231
BstSCI CCNGG 2 cut(s) 171, 229
BtsIMutI CAGTG 2 cut(s) 51, 56
Cfr13I GGNCC 1 cut(s) 41
CsiI ACCWGGT 1 cut(s) 171
Csp6I GTAC 1 cut(s) 169
CviJI RGCY 2 cut(s) 89, 166
CviKI_1 RGCY 2 cut(s) 89, 166
CviQI GTAC 1 cut(s) 169
Eco47I GGWCC 1 cut(s) 41
EcoRI GAATTC 1 cut(s) 119
EcoRII CCWGG 2 cut(s) 171, 229
FaiI YATR 3 cut(s) 22, 51, 158
FspBI CTAG 1 cut(s) 316
HincII GTYRAC 1 cut(s) 153
HindII GTYRAC 1 cut(s) 153
HinfI GANTC 1 cut(s) 98
HphI GGTGA 2 cut(s) 37, 125
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 1 cut(s) 249
Hpy8I GTNNAC 1 cut(s) 153
HpyCH4III ACNGT 2 cut(s) 60, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
LmnI GCTCC 2 cut(s) 143, 303
LpnPI CCDG 9 cut(s) 57, 147, 158, 166, 179, 185, 216, 243, 249
MabI ACCWGGT 1 cut(s) 171
MaeI CTAG 1 cut(s) 316
MboII GAAGA 2 cut(s) 128, 284
MluCI AATT 1 cut(s) 119
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 4 cut(s) 32, 232, 289, 316
MseI TTAA 1 cut(s) 240
MspR9I CCNGG 2 cut(s) 173, 231
MvaI CCWGG 2 cut(s) 173, 231
MwoI GCNNNNNNNGC 1 cut(s) 86
PleI GAGTC 1 cut(s) 92
PpsI GAGTC 1 cut(s) 92
Psp6I CCWGG 2 cut(s) 171, 229
PspGI CCWGG 2 cut(s) 171, 229
PspPI GGNCC 1 cut(s) 41
RsaI GTAC 1 cut(s) 170
RsaNI GTAC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 240
Sau96I GGNCC 1 cut(s) 41
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 2 cut(s) 173, 231
SetI ASST 4 cut(s) 91, 174, 213, 308
SexAI ACCWGGT 1 cut(s) 171
SinI GGWCC 1 cut(s) 41
Sse9I AATT 1 cut(s) 119
SspMI CTAG 1 cut(s) 316
StyD4I CCNGG 2 cut(s) 171, 229
TaaI ACNGT 2 cut(s) 60, 245
TasI AATT 1 cut(s) 119
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TscAI CASTG 2 cut(s) 51, 63
TspRI CASTG 2 cut(s) 51, 63
VpaK11BI GGWCC 1 cut(s) 41
XapI RAATTY 1 cut(s) 119
XspI CTAG 1 cut(s) 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.