Rh2DG264500

beta-galactosidase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
28484458 .. 28485403
946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG264500.1

Sequence Viewer

Length: 198 bp
ATGAATAAACACATGGAGCAATATGTGAACAAGATAATGAAGGTGATGAAGGATGAAAAGCTATTTGCTCCACAAGGAGGTCCAATCATCTTAGCTCAGATTAATACTTGCAACGGAAGGCATTGTGGAGATACTTTTTCAGGACCTAACAAACCCAACAAGCCTGCTCTATGGACTGAGAATTGGACAGCTCAGTGA

Protein Analysis

65

Amino Acids

7.37

Weight (kDa)

9.1

Isoelectric Point (pI)

33.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 77
AluBI AGCT 3 cut(s) 61, 95, 191
AluI AGCT 3 cut(s) 61, 95, 191
AseI ATTAAT 1 cut(s) 102
AspS9I GGNCC 2 cut(s) 80, 143
AsuHPI GGTGA 1 cut(s) 55
AvaII GGWCC 2 cut(s) 80, 143
Bme18I GGWCC 2 cut(s) 80, 143
BmgT120I GGNCC 2 cut(s) 80, 143
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMII CTCAG 2 cut(s) 110, 168
BslI CCNNNNNNNGG 1 cut(s) 77
BspCNI CTCAG 2 cut(s) 109, 169
BstC8I GCNNGC 1 cut(s) 165
BstDEI CTNAG 4 cut(s) 91, 96, 177, 192
BstF5I GGATG 1 cut(s) 58
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 165
Cfr13I GGNCC 2 cut(s) 80, 143
CviAII CATG 1 cut(s) 13
CviJI RGCY 4 cut(s) 61, 95, 163, 191
CviKI_1 RGCY 4 cut(s) 61, 95, 163, 191
DdeI CTNAG 4 cut(s) 91, 96, 177, 192
Eco47I GGWCC 2 cut(s) 80, 143
EcoO109I RGGNCCY 1 cut(s) 143
FaeI CATG 1 cut(s) 16
FaiI YATR 3 cut(s) 14, 24, 172
FatI CATG 1 cut(s) 12
FokI GGATG 1 cut(s) 65
Hin1II CATG 1 cut(s) 16
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 141
Hpy8I GTNNAC 1 cut(s) 28
HpyAV CCTTC 3 cut(s) 34, 43, 111
HpyCH4V TGCA 1 cut(s) 111
HpyF3I CTNAG 4 cut(s) 91, 96, 177, 192
Hsp92II CATG 1 cut(s) 16
LmnI GCTCC 2 cut(s) 16, 73
LpnPI CCDG 2 cut(s) 126, 177
MluCI AATT 1 cut(s) 181
MnlI CCTC 1 cut(s) 71
MseI TTAA 1 cut(s) 102
NlaIII CATG 1 cut(s) 16
PpuMI RGGWCCY 1 cut(s) 143
PshBI ATTAAT 1 cut(s) 102
Psp5II RGGWCCY 1 cut(s) 143
PspPI GGNCC 2 cut(s) 80, 143
PspPPI RGGWCCY 1 cut(s) 143
SaqAI TTAA 1 cut(s) 102
Sau96I GGNCC 2 cut(s) 80, 143
SetI ASST 6 cut(s) 45, 63, 82, 97, 148, 193
SgeI CNNG 7 cut(s) 25, 43, 86, 120, 153, 172, 176
SinI GGWCC 2 cut(s) 80, 143
Sse9I AATT 1 cut(s) 181
TasI AATT 1 cut(s) 181
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspDTI ATGAA 4 cut(s) 17, 53, 62, 69
TspGWI ACGGA 1 cut(s) 129
VpaK11BI GGWCC 2 cut(s) 80, 143
VspI ATTAAT 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.