Rh2DG606500

hydrolase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
84075346 .. 84075926
581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG606500.1

Sequence Viewer

Length: 315 bp
ATGATATTAGTTGGACCAAGCCTTGGTGCTTCTGTTGCAATTGACTTTGCAGTTAGTTATCCGTTTGCTGTTGAAAAGCTGGTTTTGATTAATGCAAGTGTGTACGCAGAAGGCACCAAAGGCCTTGCAGAATTTCCTAGAGTATTAGCCTATGCTGGGGTTTCCTTGTTGAGGAGCATCTCTCTACGGCTTTACGCCAATACGCTGGCCTTCAATGACATTTCATTAGCTACAACCTTTGATTGGACTAATGTACAATTATCTTTTGTTAACCAATATTTGTTCAACTTTACATTGACATGTTTGTTTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

104

Amino Acids

11.35

Weight (kDa)

4.99

Isoelectric Point (pI)

24.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 113
AccB7I CCANNNNNTGG 1 cut(s) 23
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 2 cut(s) 104, 255
AfiI CCNNNNNNNGG 4 cut(s) 23, 156, 171, 243
AflIII ACRYGT 1 cut(s) 299
AgsI TTSAA 3 cut(s) 74, 214, 286
AluBI AGCT 2 cut(s) 79, 230
AluI AGCT 2 cut(s) 79, 230
AoxI GGCC 2 cut(s) 121, 207
ApoI RAATTY 1 cut(s) 131
AseI ATTAAT 1 cut(s) 90
AspS9I GGNCC 1 cut(s) 14
AvaII GGWCC 1 cut(s) 14
BanI GGYRCC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 203
BfaI CTAG 1 cut(s) 138
Bme18I GGWCC 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 14
BmiI GGNNCC 1 cut(s) 115
BmsI GCATC 1 cut(s) 186
BplI GAGNNNNNCTC 2 cut(s) 166, 198
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 4 cut(s) 23, 156, 171, 243
BseDI CCNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 4 cut(s) 23, 156, 171, 243
BseRI GAGGAG 1 cut(s) 187
BseYI CCCAGC 1 cut(s) 155
BshFI GGCC 2 cut(s) 123, 209
BshNI GGYRCC 1 cut(s) 113
BslI CCNNNNNNNGG 4 cut(s) 23, 156, 171, 243
BsnI GGCC 2 cut(s) 123, 209
Bsp1407I TGTACA 1 cut(s) 253
BspANI GGCC 2 cut(s) 123, 209
BspLI GGNNCC 1 cut(s) 115
BspT107I GGYRCC 1 cut(s) 113
BsrGI TGTACA 1 cut(s) 253
BssECI CCNNGG 1 cut(s) 22
BssT1I CCWWGG 1 cut(s) 22
BstAUI TGTACA 1 cut(s) 253
BstC8I GCNNGC 1 cut(s) 207
BstENI CCTNNNNNAGG 1 cut(s) 169
BstMWI GCNNNNNNNGC 2 cut(s) 35, 120
BstNSI RCATGY 1 cut(s) 303
BstXI CCANNNNNNTGG 1 cut(s) 205
BsuRI GGCC 2 cut(s) 123, 209
Cac8I GCNNGC 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 14
Csp6I GTAC 2 cut(s) 103, 254
CviAII CATG 1 cut(s) 300
CviJI RGCY 7 cut(s) 21, 79, 123, 149, 190, 209, 230
CviKI_1 RGCY 7 cut(s) 21, 79, 123, 149, 190, 209, 230
CviQI GTAC 2 cut(s) 103, 254
Eco130I CCWWGG 1 cut(s) 22
Eco147I AGGCCT 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 14
EcoNI CCTNNNNNAGG 1 cut(s) 169
EcoT14I CCWWGG 1 cut(s) 22
ErhI CCWWGG 1 cut(s) 22
FaeI CATG 1 cut(s) 303
FaiI YATR 2 cut(s) 153, 301
FatI CATG 1 cut(s) 299
FspBI CTAG 1 cut(s) 138
GsaI CCCAGC 1 cut(s) 159
HaeIII GGCC 2 cut(s) 123, 209
Hin1II CATG 1 cut(s) 303
HincII GTYRAC 1 cut(s) 271
HindII GTYRAC 1 cut(s) 271
HpaI GTTAAC 1 cut(s) 271
Hpy166II GTNNAC 2 cut(s) 103, 271
Hpy8I GTNNAC 2 cut(s) 103, 271
HpyAV CCTTC 2 cut(s) 104, 220
HpyCH4V TGCA 4 cut(s) 38, 50, 95, 128
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 120
Hsp92II CATG 1 cut(s) 303
KspAI GTTAAC 1 cut(s) 271
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 3 cut(s) 65, 141, 191
LweI GCATC 1 cut(s) 186
MaeI CTAG 1 cut(s) 138
MfeI CAATTG 1 cut(s) 39
MluCI AATT 3 cut(s) 39, 131, 257
MnlI CCTC 1 cut(s) 165
MseI TTAA 3 cut(s) 90, 270, 313
MslI CAYNNNNRTG 1 cut(s) 298
MunI CAATTG 1 cut(s) 39
MwoI GCNNNNNNNGC 2 cut(s) 35, 120
NlaIII CATG 1 cut(s) 303
NlaIV GGNNCC 1 cut(s) 115
NspI RCATGY 1 cut(s) 303
PceI AGGCCT 1 cut(s) 123
PciI ACATGT 1 cut(s) 299
PflMI CCANNNNNTGG 1 cut(s) 23
PscI ACATGT 1 cut(s) 299
PshBI ATTAAT 1 cut(s) 90
PspFI CCCAGC 1 cut(s) 155
PspN4I GGNNCC 1 cut(s) 115
PspPI GGNCC 1 cut(s) 14
RsaI GTAC 2 cut(s) 104, 255
RsaNI GTAC 2 cut(s) 103, 254
RseI CAYNNNNRTG 1 cut(s) 298
SaqAI TTAA 3 cut(s) 90, 270, 313
Sau96I GGNCC 1 cut(s) 14
SetI ASST 3 cut(s) 81, 232, 239
SfaNI GCATC 1 cut(s) 186
SgeI CNNG 9 cut(s) 30, 35, 92, 108, 137, 150, 168, 178, 218
SinI GGWCC 1 cut(s) 14
SmiMI CAYNNNNRTG 1 cut(s) 298
Sse9I AATT 3 cut(s) 39, 131, 257
SseBI AGGCCT 1 cut(s) 123
SspI AATATT 1 cut(s) 278
SspMI CTAG 1 cut(s) 138
StuI AGGCCT 1 cut(s) 123
StyI CCWWGG 1 cut(s) 22
TasI AATT 3 cut(s) 39, 131, 257
TatI WGTACW 1 cut(s) 253
Tru1I TTAA 3 cut(s) 90, 270, 313
Tru9I TTAA 3 cut(s) 90, 270, 313
TspDTI ATGAA 1 cut(s) 213
TspGWI ACGGA 1 cut(s) 51
Van91I CCANNNNNTGG 1 cut(s) 23
VpaK11BI GGWCC 1 cut(s) 14
VspI ATTAAT 1 cut(s) 90
XagI CCTNNNNNAGG 1 cut(s) 169
XapI RAATTY 1 cut(s) 131
XceI RCATGY 1 cut(s) 303
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.