Rh3AG130400

phosphatase 2C

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
11288721 .. 11288954
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG130400.1

Sequence Viewer

Length: 234 bp
ATGGGGTCTTGTGTGCTGGTGATGTTGATGAAGGGAGATGATGTTTACTTGATGAATATTGGGGATAGTAGTGCGGTTTTAGCTCAGAAAGTAGATCCCAAGATCAAGCAAAACTTTGAATGGATTAATAAGGAAACTTTATGCAAGCGTCGATCATCTAGTGCTGATGAGCTTTACAGTTTAAACAATTTGACTTCGGTGCTGACAATCGATCACAGCACAAATGTGAAAGAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.74

Weight (kDa)

5.73

Isoelectric Point (pI)

37.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 74
AclWI GGATC 1 cut(s) 89
AgsI TTSAA 1 cut(s) 119
AleI CACNNNNGTG 1 cut(s) 224
AluBI AGCT 2 cut(s) 83, 172
AluI AGCT 2 cut(s) 83, 172
AlwI GGATC 1 cut(s) 89
AseI ATTAAT 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 31
BfaI CTAG 1 cut(s) 159
Bsa29I ATCGAT 1 cut(s) 210
BsaXI ACNNNNNCTCC 2 cut(s) 27, 57
BseCI ATCGAT 1 cut(s) 210
BseMII CTCAG 1 cut(s) 98
BshVI ATCGAT 1 cut(s) 210
Bsp143I GATC 4 cut(s) 94, 102, 152, 211
BspACI CCGC 1 cut(s) 74
BspCNI CTCAG 1 cut(s) 97
BspDI ATCGAT 1 cut(s) 210
BspPI GGATC 1 cut(s) 89
BssMI GATC 4 cut(s) 94, 102, 152, 211
Bst4CI ACNGT 1 cut(s) 179
BstC8I GCNNGC 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 84
BstKTI GATC 4 cut(s) 97, 105, 155, 214
BstMBI GATC 4 cut(s) 94, 102, 152, 211
BstMWI GCNNNNNNNGC 1 cut(s) 80
BstX2I RGATCY 1 cut(s) 94
BstYI RGATCY 1 cut(s) 94
Bsu15I ATCGAT 1 cut(s) 210
BsuTUI ATCGAT 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 146
ClaI ATCGAT 1 cut(s) 210
CseI GACGC 1 cut(s) 137
CviJI RGCY 2 cut(s) 83, 172
CviKI_1 RGCY 2 cut(s) 83, 172
DdeI CTNAG 1 cut(s) 84
DpnI GATC 4 cut(s) 96, 104, 154, 213
DpnII GATC 4 cut(s) 94, 102, 152, 211
DraI TTTAAA 1 cut(s) 183
FaiI YATR 1 cut(s) 142
FalI AAGNNNNNCTT 2 cut(s) 98, 130
FspBI CTAG 1 cut(s) 159
HgaI GACGC 1 cut(s) 137
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 87
Hpy8I GTNNAC 1 cut(s) 46
Hpy99I CGWCG 1 cut(s) 153
HpyAV CCTTC 1 cut(s) 25
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4V TGCA 1 cut(s) 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 84
Kzo9I GATC 4 cut(s) 94, 102, 152, 211
LpnPI CCDG 1 cut(s) 2
MaeI CTAG 1 cut(s) 159
MalI GATC 4 cut(s) 96, 104, 154, 213
MboI GATC 4 cut(s) 94, 102, 152, 211
MflI RGATCY 1 cut(s) 94
MluCI AATT 1 cut(s) 187
MseI TTAA 2 cut(s) 126, 182
MslI CAYNNNNRTG 1 cut(s) 224
MssI GTTTAAAC 1 cut(s) 183
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 4 cut(s) 94, 102, 152, 211
OliI CACNNNNGTG 1 cut(s) 224
PmeI GTTTAAAC 1 cut(s) 183
PshBI ATTAAT 1 cut(s) 126
PsuI RGATCY 1 cut(s) 94
RseI CAYNNNNRTG 1 cut(s) 224
SaqAI TTAA 2 cut(s) 126, 182
Sau3AI GATC 4 cut(s) 94, 102, 152, 211
SetI ASST 2 cut(s) 85, 174
SgeI CNNG 7 cut(s) 21, 29, 61, 112, 118, 157, 171
SmiMI CAYNNNNRTG 1 cut(s) 224
Sse9I AATT 1 cut(s) 187
SsiI CCGC 1 cut(s) 74
SspI AATATT 1 cut(s) 58
SspMI CTAG 1 cut(s) 159
TaaI ACNGT 1 cut(s) 179
TaqI TCGA 2 cut(s) 151, 210
TasI AATT 1 cut(s) 187
Tru1I TTAA 2 cut(s) 126, 182
Tru9I TTAA 2 cut(s) 126, 182
TspDTI ATGAA 2 cut(s) 44, 68
VspI ATTAAT 1 cut(s) 126
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.