Rh3CG119200
ERF Family

Gamma-interferon-inducible lysosomal thiol

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
9622565 .. 9624510
1946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG119200.1

Sequence Viewer

Length: 630 bp
ATGGCTTCTCATAAGTTCTTCTCCATCACTGTTCTAACAGCTTTGCTCTCGCTCTGCACCAATGCTCTGTCTCGTACGGAATACAATTGCTCTTCTCAGAAAGTTAACCTAACTATATATTATGACACTCTTAGCCCGTACTGTGAGGAATTCATTGTATATGAGCTTCCAAAGGCATTTGAGCTGGAACTCATGCACATTATCAACCTCCGTCTAGTACCATCTGGAAATGCTTACATCCAAGAACCTAACAACACCATCAGTTGCCAGGATGGCCCAGCTGAATGCTACTTGAACAGTATAGAAGCTTGTGTAATCAGCATCTGGCCGGATGTGAATAAACATTTCAAATTTATTCACTGTGTTGCATGGCAAAACTTGGGACGATTACAGTTAAAAGAAGATGCATGGAAATCATGTTCTAAAATAACGATGCTGAGTGACAAACCTGTCTCAAATTGCTACAAAAGCGGATATGCGAAAAAGGTTTACAGGTGTTTAACCGAGTATAGAGGAAGTAGGTCCTTTTCGGAACTGTCCAGCAGAACTACAGTATCAAAATCACTCCCAAATACACCCAAGAGTGAAGTTCAACAGCACCATGACATGCAGTCATTTGGTGGGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

209

Amino Acids

23.77

Weight (kDa)

8.0

Isoelectric Point (pI)

50.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GILT PF03227 36 - 142 6.1e-26 Gamma interferon inducible lysosomal thiol reductase (GILT)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 449
AciI CCGC 1 cut(s) 471
AcoI YGGCCR 1 cut(s) 326
AcsI RAATTY 2 cut(s) 149, 350
AfaI GTAC 3 cut(s) 76, 140, 219
AgsI TTSAA 3 cut(s) 295, 349, 593
AhdI GACNNNNNGTC 1 cut(s) 610
AjnI CCWGG 1 cut(s) 267
AloI GAACNNNNNNTCC 2 cut(s) 403, 435
AluBI AGCT 5 cut(s) 41, 166, 184, 281, 308
AluI AGCT 5 cut(s) 41, 166, 184, 281, 308
Alw26I GTCTC 2 cut(s) 75, 457
AlwNI CAGNNNCTG 1 cut(s) 324
AoxI GGCC 2 cut(s) 274, 326
ApoI RAATTY 2 cut(s) 149, 350
AspS9I GGNCC 2 cut(s) 275, 522
AvaII GGWCC 1 cut(s) 522
BaeI ACNNNNGTAYC 2 cut(s) 537, 570
BarI GAAGNNNNNNTAC 2 cut(s) 150, 182
BccI CCATC 4 cut(s) 32, 229, 266, 266
BciT130I CCWGG 1 cut(s) 269
BcoDI GTCTC 2 cut(s) 75, 457
BfaI CTAG 1 cut(s) 215
BfmI CTRYAG 1 cut(s) 549
BglI GCCNNNNNGGC 1 cut(s) 273
Bme1390I CCNGG 1 cut(s) 269
Bme18I GGWCC 1 cut(s) 522
BmeRI GACNNNNNGTC 1 cut(s) 610
BmgT120I GGNCC 2 cut(s) 275, 522
BmrFI CCNGG 1 cut(s) 269
BmsI GCATC 3 cut(s) 330, 394, 423
BseBI CCWGG 1 cut(s) 269
BseGI GGATG 3 cut(s) 237, 277, 337
BseMII CTCAG 2 cut(s) 110, 428
BseYI CCCAGC 1 cut(s) 277
BsgI GTGCAG 1 cut(s) 40
BshFI GGCC 2 cut(s) 276, 328
BsiSI CCGG 1 cut(s) 329
BsiWI CGTACG 1 cut(s) 74
BslFI GGGAC 1 cut(s) 396
BsmAI GTCTC 2 cut(s) 75, 457
BsmFI GGGAC 1 cut(s) 396
BsmI GAATGC 1 cut(s) 290
BsnI GGCC 2 cut(s) 276, 328
BspACI CCGC 1 cut(s) 471
BspANI GGCC 2 cut(s) 276, 328
BspCNI CTCAG 2 cut(s) 109, 429
BspQI GCTCTTC 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 269
Bst4CI ACNGT 7 cut(s) 31, 143, 299, 362, 393, 537, 553
Bst6I CTCTTC 1 cut(s) 97
BstDEI CTNAG 3 cut(s) 96, 131, 437
BstF5I GGATG 3 cut(s) 237, 277, 337
BstMAI GTCTC 2 cut(s) 75, 457
BstMWI GCNNNNNNNGC 2 cut(s) 273, 468
BstNI CCWGG 1 cut(s) 269
BstNSI RCATGY 1 cut(s) 610
BstSCI CCNGG 1 cut(s) 267
BstSFI CTRYAG 1 cut(s) 549
BsuRI GGCC 2 cut(s) 276, 328
BtsCI GGATG 3 cut(s) 237, 277, 337
BtsIMutI CAGTG 2 cut(s) 27, 358
CaiI CAGNNNCTG 1 cut(s) 324
Cfr13I GGNCC 2 cut(s) 275, 522
Csp6I GTAC 3 cut(s) 75, 139, 218
CviAII CATG 6 cut(s) 193, 369, 408, 417, 602, 607
CviJI RGCY 9 cut(s) 5, 41, 135, 166, 184, 276, 281, 308, 328
CviKI_1 RGCY 9 cut(s) 5, 41, 135, 166, 184, 276, 281, 308, 328
CviQI GTAC 3 cut(s) 75, 139, 218
DdeI CTNAG 3 cut(s) 96, 131, 437
DrdI GACNNNNNNGTC 1 cut(s) 449
DriI GACNNNNNGTC 1 cut(s) 610
DseDI GACNNNNNNGTC 1 cut(s) 449
EaeI YGGCCR 1 cut(s) 326
Eam1104I CTCTTC 1 cut(s) 97
Eam1105I GACNNNNNGTC 1 cut(s) 610
EarI CTCTTC 1 cut(s) 97
Eco47I GGWCC 1 cut(s) 522
EcoO109I RGGNCCY 1 cut(s) 522
EcoRI GAATTC 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 267
EcoT22I ATGCAT 1 cut(s) 409
FaeI CATG 6 cut(s) 196, 372, 411, 420, 605, 610
FaqI GGGAC 1 cut(s) 396
FatI CATG 6 cut(s) 192, 368, 407, 416, 601, 606
FokI GGATG 3 cut(s) 224, 284, 344
FspBI CTAG 1 cut(s) 215
GsaI CCCAGC 1 cut(s) 281
HaeIII GGCC 2 cut(s) 276, 328
HapII CCGG 1 cut(s) 329
Hin1II CATG 6 cut(s) 196, 372, 411, 420, 605, 610
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 306
HpaI GTTAAC 1 cut(s) 106
HpaII CCGG 1 cut(s) 329
Hpy166II GTNNAC 2 cut(s) 106, 490
Hpy188I TCNGA 2 cut(s) 99, 532
Hpy188III TCNNGA 1 cut(s) 225
Hpy8I GTNNAC 2 cut(s) 106, 490
HpyCH4III ACNGT 7 cut(s) 31, 143, 299, 362, 393, 537, 553
HpyCH4V TGCA 5 cut(s) 57, 196, 368, 407, 610
HpyF10VI GCNNNNNNNGC 2 cut(s) 273, 468
HpyF3I CTNAG 3 cut(s) 96, 131, 437
Hsp92II CATG 6 cut(s) 196, 372, 411, 420, 605, 610
KspAI GTTAAC 1 cut(s) 106
LguI GCTCTTC 1 cut(s) 97
LweI GCATC 3 cut(s) 330, 394, 423
MaeI CTAG 1 cut(s) 215
MaeIII GTNAC 1 cut(s) 440
MboII GAAGA 3 cut(s) 10, 84, 413
MfeI CAATTG 1 cut(s) 85
MluCI AATT 4 cut(s) 85, 149, 350, 457
MnlI CCTC 3 cut(s) 139, 218, 506
Mph1103I ATGCAT 1 cut(s) 409
MseI TTAA 3 cut(s) 105, 395, 500
MspA1I CMGCKG 1 cut(s) 281
MspI CCGG 1 cut(s) 329
MspR9I CCNGG 1 cut(s) 269
MunI CAATTG 1 cut(s) 85
Mva1269I GAATGC 1 cut(s) 290
MvaI CCWGG 1 cut(s) 269
MwoI GCNNNNNNNGC 2 cut(s) 273, 468
NlaIII CATG 6 cut(s) 196, 372, 411, 420, 605, 610
NmuCI GTSAC 1 cut(s) 440
NsiI ATGCAT 1 cut(s) 409
NspI RCATGY 1 cut(s) 610
PciSI GCTCTTC 1 cut(s) 97
PctI GAATGC 1 cut(s) 290
Pfl23II CGTACG 1 cut(s) 74
PpuMI RGGWCCY 1 cut(s) 522
Psp5II RGGWCCY 1 cut(s) 522
Psp6I CCWGG 1 cut(s) 267
PspFI CCCAGC 1 cut(s) 277
PspGI CCWGG 1 cut(s) 267
PspLI CGTACG 1 cut(s) 74
PspPI GGNCC 2 cut(s) 275, 522
PspPPI RGGWCCY 1 cut(s) 522
PstNI CAGNNNCTG 1 cut(s) 324
PvuII CAGCTG 1 cut(s) 281
RsaI GTAC 3 cut(s) 76, 140, 219
RsaNI GTAC 3 cut(s) 75, 139, 218
SapI GCTCTTC 1 cut(s) 97
SaqAI TTAA 3 cut(s) 105, 395, 500
Sau96I GGNCC 2 cut(s) 275, 522
ScrFI CCNGG 1 cut(s) 269
SfaNI GCATC 3 cut(s) 330, 394, 423
SfcI CTRYAG 1 cut(s) 549
SinI GGWCC 1 cut(s) 522
Sse9I AATT 4 cut(s) 85, 149, 350, 457
SsiI CCGC 1 cut(s) 471
SspMI CTAG 1 cut(s) 215
StyD4I CCNGG 1 cut(s) 267
TaaI ACNGT 7 cut(s) 31, 143, 299, 362, 393, 537, 553
TasI AATT 4 cut(s) 85, 149, 350, 457
Tru1I TTAA 3 cut(s) 105, 395, 500
Tru9I TTAA 3 cut(s) 105, 395, 500
TscAI CASTG 2 cut(s) 34, 365
TseFI GTSAC 1 cut(s) 440
Tsp45I GTSAC 1 cut(s) 440
TspDTI ATGAA 1 cut(s) 142
TspGWI ACGGA 2 cut(s) 92, 200
TspRI CASTG 2 cut(s) 34, 365
VpaK11BI GGWCC 1 cut(s) 522
XapI RAATTY 2 cut(s) 149, 350
XceI RCATGY 1 cut(s) 610
XspI CTAG 1 cut(s) 215
Zsp2I ATGCAT 1 cut(s) 409
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.