Rh4AG241100

Rop guanine nucleotide exchange factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
54791898 .. 54792342
445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG241100.1

Sequence Viewer

Length: 246 bp
ATGGTTGAGCTAGTTCATTCCAGGAAAAATGGTGCTAATGGCCGGACATTAGAGATTATGACTCCGAAAGCTCGTGCAGACATACACATCAATCTTCCAGCACTTAAGAAGTTGGACTCGATGCTTATTGAAACACTTGATTCATTGGTGGTTACTGAGTTTGGGTATGTAGAAGGTGGTAGCAGGGCAGAAGGACGAAACAGAACTCCAGGTCAGAGCAAGAGATGGTGGCTCCCATCACCTTAG

Protein Analysis

81

Amino Acids

9.04

Weight (kDa)

9.69

Isoelectric Point (pI)

62.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PRONE PF03759 1 - 81 1.4e-28 PRONE (Plant-specific Rop nucleotide exchanger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 40
AflII CTTAAG 1 cut(s) 104
AgsI TTSAA 1 cut(s) 131
AjnI CCWGG 2 cut(s) 20, 208
AluBI AGCT 2 cut(s) 10, 71
AluI AGCT 2 cut(s) 10, 71
AoxI GGCC 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 231
BauI CACGAG 1 cut(s) 72
BccI CCATC 2 cut(s) 219, 244
BciT130I CCWGG 2 cut(s) 22, 210
BfaI CTAG 1 cut(s) 11
BfrI CTTAAG 1 cut(s) 104
Bme1390I CCNGG 2 cut(s) 22, 210
BmiI GGNNCC 1 cut(s) 233
BmrFI CCNGG 2 cut(s) 22, 210
BmsI GCATC 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 192
BseBI CCWGG 2 cut(s) 22, 210
BseMII CTCAG 1 cut(s) 147
BsgI GTGCAG 1 cut(s) 96
BshFI GGCC 1 cut(s) 42
BsiSI CCGG 1 cut(s) 43
BsnI GGCC 1 cut(s) 42
BspANI GGCC 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 233
BspTI CTTAAG 1 cut(s) 104
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
Bst2UI CCWGG 2 cut(s) 22, 210
BstAFI CTTAAG 1 cut(s) 104
BstDEI CTNAG 2 cut(s) 156, 243
BstNI CCWGG 2 cut(s) 22, 210
BstSCI CCNGG 2 cut(s) 20, 208
BsuRI GGCC 1 cut(s) 42
CviJI RGCY 4 cut(s) 10, 42, 71, 232
CviKI_1 RGCY 4 cut(s) 10, 42, 71, 232
DdeI CTNAG 2 cut(s) 156, 243
EaeI YGGCCR 1 cut(s) 40
EcoRII CCWGG 2 cut(s) 20, 208
FaiI YATR 3 cut(s) 59, 83, 168
FspBI CTAG 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 192
HaeIII GGCC 1 cut(s) 42
HapII CCGG 1 cut(s) 43
HinfI GANTC 3 cut(s) 61, 116, 140
HpaII CCGG 1 cut(s) 43
HphI GGTGA 1 cut(s) 231
Hpy188I TCNGA 2 cut(s) 66, 216
HpyAV CCTTC 2 cut(s) 167, 185
HpyCH4V TGCA 1 cut(s) 77
HpyF3I CTNAG 2 cut(s) 156, 243
LmnI GCTCC 1 cut(s) 237
LpnPI CCDG 7 cut(s) 7, 34, 56, 111, 169, 195, 222
LweI GCATC 1 cut(s) 111
MaeI CTAG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 151
MboII GAAGA 1 cut(s) 86
MlyI GAGTC 2 cut(s) 55, 110
MmeI TCCRAC 1 cut(s) 93
MseI TTAA 1 cut(s) 105
MspCI CTTAAG 1 cut(s) 104
MspI CCGG 1 cut(s) 43
MspR9I CCNGG 2 cut(s) 22, 210
MvaI CCWGG 2 cut(s) 22, 210
NlaIV GGNNCC 1 cut(s) 233
PfeI GAWTC 1 cut(s) 140
PfoI TCCNGGA 1 cut(s) 20
PleI GAGTC 2 cut(s) 55, 110
PpsI GAGTC 2 cut(s) 55, 110
Psp6I CCWGG 2 cut(s) 20, 208
PspGI CCWGG 2 cut(s) 20, 208
PspN4I GGNNCC 1 cut(s) 233
SaqAI TTAA 1 cut(s) 105
SchI GAGTC 2 cut(s) 55, 110
ScrFI CCNGG 2 cut(s) 22, 210
SetI ASST 5 cut(s) 12, 73, 178, 214, 244
SfaNI GCATC 1 cut(s) 111
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
SspMI CTAG 1 cut(s) 11
StyD4I CCNGG 2 cut(s) 20, 208
TaqI TCGA 1 cut(s) 119
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TspDTI ATGAA 2 cut(s) 5, 132
Vha464I CTTAAG 1 cut(s) 104
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.