Rh5AG463000

Rop guanine nucleotide exchange factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
79198214 .. 79205978
7765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG463000.1

Sequence Viewer

Length: 267 bp
ATGAGCAGGCCACTACCTAGAAACACCAAACAGGTTGAATGGCAAAATGGTGCTAATGGCCGGACAGTAGAGATTATGATTCCGAAAGCTCGTGCAGATATACACATCAATCTTCCAGCACTTAAGAAGTTGGACTCGATGCTTATTGAAACACTTGATTCAATGGTGGATACTGAGTTTGGGTATGTAGAAGGTGGTAGCAGGGCAGAAGGACGAAACAGAACTCTAGGTCAGAGCATGAGATGGTGGCTCCCATCACCTCAGTGA

Protein Analysis

88

Amino Acids

9.99

Weight (kDa)

9.39

Isoelectric Point (pI)

62.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PRONE PF03759 13 - 88 2.1e-27 PRONE (Plant-specific Rop nucleotide exchanger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 58
AflII CTTAAG 1 cut(s) 122
AgsI TTSAA 3 cut(s) 38, 149, 162
AleI CACNNNNGTG 1 cut(s) 262
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AoxI GGCC 2 cut(s) 8, 58
AsuHPI GGTGA 1 cut(s) 249
BauI CACGAG 1 cut(s) 90
BccI CCATC 2 cut(s) 237, 262
BciVI GTATCC 1 cut(s) 163
BfaI CTAG 2 cut(s) 18, 227
BfrI CTTAAG 1 cut(s) 122
BfuI GTATCC 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 251
BmsI GCATC 1 cut(s) 129
BseMII CTCAG 1 cut(s) 165
BsgI GTGCAG 1 cut(s) 114
BshFI GGCC 2 cut(s) 10, 60
BsiSI CCGG 1 cut(s) 61
BsnI GGCC 2 cut(s) 10, 60
BspANI GGCC 2 cut(s) 10, 60
BspCNI CTCAG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 251
BspTI CTTAAG 1 cut(s) 122
BssSI CACGAG 1 cut(s) 90
Bst2BI CACGAG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 67
BstAFI CTTAAG 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 8
BstDEI CTNAG 2 cut(s) 174, 261
BsuI GTATCC 1 cut(s) 163
BsuRI GGCC 2 cut(s) 10, 60
Cac8I GCNNGC 1 cut(s) 8
CviAII CATG 1 cut(s) 238
CviJI RGCY 4 cut(s) 10, 60, 89, 250
CviKI_1 RGCY 4 cut(s) 10, 60, 89, 250
DdeI CTNAG 2 cut(s) 174, 261
EaeI YGGCCR 1 cut(s) 58
FaeI CATG 1 cut(s) 241
FaiI YATR 4 cut(s) 77, 101, 186, 239
FatI CATG 1 cut(s) 237
FspBI CTAG 2 cut(s) 18, 227
HaeIII GGCC 2 cut(s) 10, 60
HapII CCGG 1 cut(s) 61
Hin1II CATG 1 cut(s) 241
HinfI GANTC 3 cut(s) 79, 134, 158
HpaII CCGG 1 cut(s) 61
HphI GGTGA 1 cut(s) 249
Hpy188I TCNGA 2 cut(s) 84, 234
HpyAV CCTTC 2 cut(s) 185, 203
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 95
HpyF3I CTNAG 2 cut(s) 174, 261
Hsp92II CATG 1 cut(s) 241
LmnI GCTCC 1 cut(s) 255
LpnPI CCDG 4 cut(s) 17, 74, 129, 187
LweI GCATC 1 cut(s) 129
MaeI CTAG 2 cut(s) 18, 227
MboII GAAGA 1 cut(s) 104
MlyI GAGTC 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 111
MseI TTAA 1 cut(s) 123
MslI CAYNNNNRTG 1 cut(s) 262
MspCI CTTAAG 1 cut(s) 122
MspI CCGG 1 cut(s) 61
NlaIII CATG 1 cut(s) 241
NlaIV GGNNCC 1 cut(s) 251
OliI CACNNNNGTG 1 cut(s) 262
PfeI GAWTC 2 cut(s) 79, 158
PleI GAGTC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 251
RseI CAYNNNNRTG 1 cut(s) 262
SaqAI TTAA 1 cut(s) 123
SchI GAGTC 1 cut(s) 128
SetI ASST 6 cut(s) 19, 36, 91, 196, 232, 262
SfaNI GCATC 1 cut(s) 129
SmiMI CAYNNNNRTG 1 cut(s) 262
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
SspMI CTAG 2 cut(s) 18, 227
TaaI ACNGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 137
TfiI GAWTC 2 cut(s) 79, 158
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
Vha464I CTTAAG 1 cut(s) 122
XspI CTAG 2 cut(s) 18, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.