Rh4AG270300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0008885
Physical Location & Seq
Forward (+)
58670258 .. 58672325
2068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG270300.1

Sequence Viewer

Length: 351 bp
ATGGCTTCCTCGAAGGTTGTTTCTAGGTTATCGTCCCGATCATCACAAAGCCTCGGGCACAATCTCATCAAGACATGGACGGACTCCTCCAAATTCTCATCACTCAAATCGAGCTTTCACTCGGAGGCATGCACTACAGTTCGACCTGTTGCTCCCACCTCAAGTGGTTCAGTGCCTCGAGTTGGTCTTGGGGATGGGATCAGTTCCTTACACAGAGGGCCAAGTTTTTCAAGAAAGATCAATGCATTGTGGAGGCAGAAATCACTATTAAAGGAATTTCTAGTTAACCCAGCTAGATATATAGATTTGAAGCCGTTGGCAACTTGGCATAACTTTCACTGCGTCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

12.74

Weight (kDa)

10.74

Isoelectric Point (pI)

53.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 206
AcsI RAATTY 2 cut(s) 92, 275
AfiI CCNNNNNNNGG 1 cut(s) 182
AgsI TTSAA 2 cut(s) 231, 310
AluBI AGCT 2 cut(s) 114, 293
AluI AGCT 2 cut(s) 114, 293
AlwI GGATC 1 cut(s) 206
Ama87I CYCGRG 2 cut(s) 53, 177
AoxI GGCC 1 cut(s) 218
ApoI RAATTY 2 cut(s) 92, 275
AspS9I GGNCC 1 cut(s) 218
AvaI CYCGRG 2 cut(s) 53, 177
BaeGI GKGCMC 1 cut(s) 60
BccI CCATC 1 cut(s) 188
BceAI ACGGC 1 cut(s) 298
BfaI CTAG 3 cut(s) 24, 281, 294
BfmI CTRYAG 1 cut(s) 135
BmeT110I CYCGRG 2 cut(s) 53, 177
BmgT120I GGNCC 1 cut(s) 218
BpuEI CTTGAG 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 52
BseGI GGATG 1 cut(s) 199
BseLI CCNNNNNNNGG 1 cut(s) 182
BseRI GAGGAG 1 cut(s) 76
BseSI GKGCMC 1 cut(s) 60
BseYI CCCAGC 1 cut(s) 289
BshFI GGCC 1 cut(s) 220
BsiHKCI CYCGRG 2 cut(s) 53, 177
BslFI GGGAC 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 182
BsmFI GGGAC 1 cut(s) 19
BsnI GGCC 1 cut(s) 220
BsoBI CYCGRG 2 cut(s) 53, 177
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 3 cut(s) 38, 198, 237
BspANI GGCC 1 cut(s) 220
BspPI GGATC 1 cut(s) 206
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 3 cut(s) 38, 198, 237
Bst4CI ACNGT 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 130
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 3 cut(s) 41, 201, 240
BstMBI GATC 3 cut(s) 38, 198, 237
BstNSI RCATGY 1 cut(s) 132
BstSFI CTRYAG 1 cut(s) 135
BstSLI GKGCMC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 220
BtsCI GGATG 1 cut(s) 199
BtsI GCAGTG 1 cut(s) 337
BtsIMutI CAGTG 2 cut(s) 177, 337
Cac8I GCNNGC 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 218
CseI GACGC 1 cut(s) 331
CviAII CATG 2 cut(s) 75, 129
CviJI RGCY 6 cut(s) 5, 51, 114, 220, 293, 313
CviKI_1 RGCY 6 cut(s) 5, 51, 114, 220, 293, 313
DpnI GATC 3 cut(s) 40, 200, 239
DpnII GATC 3 cut(s) 38, 198, 237
Eco88I CYCGRG 2 cut(s) 53, 177
EcoT22I ATGCAT 1 cut(s) 247
FaeI CATG 2 cut(s) 78, 132
FaiI YATR 6 cut(s) 76, 130, 300, 302, 330, 349
FaqI GGGAC 1 cut(s) 19
FatI CATG 2 cut(s) 74, 128
FokI GGATG 1 cut(s) 206
FspBI CTAG 3 cut(s) 24, 281, 294
GsaI CCCAGC 1 cut(s) 293
HaeIII GGCC 1 cut(s) 220
HgaI GACGC 1 cut(s) 331
Hin1II CATG 2 cut(s) 78, 132
HincII GTYRAC 1 cut(s) 286
HindII GTYRAC 1 cut(s) 286
HinfI GANTC 1 cut(s) 83
HpaI GTTAAC 1 cut(s) 286
Hpy166II GTNNAC 1 cut(s) 286
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 3 cut(s) 36, 70, 231
Hpy8I GTNNAC 1 cut(s) 286
HpyAV CCTTC 1 cut(s) 7
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 132, 245
Hsp92II CATG 2 cut(s) 78, 132
KspAI GTTAAC 1 cut(s) 286
Kzo9I GATC 3 cut(s) 38, 198, 237
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 2 cut(s) 159, 303
MaeI CTAG 3 cut(s) 24, 281, 294
MalI GATC 3 cut(s) 40, 200, 239
MboI GATC 3 cut(s) 38, 198, 237
MhlI GDGCHC 1 cut(s) 60
MluCI AATT 2 cut(s) 92, 275
MlyI GAGTC 1 cut(s) 77
MnlI CCTC 8 cut(s) 19, 62, 97, 118, 169, 186, 209, 246
Mph1103I ATGCAT 1 cut(s) 247
MseI TTAA 2 cut(s) 269, 285
NdeII GATC 3 cut(s) 38, 198, 237
NlaIII CATG 2 cut(s) 78, 132
NsiI ATGCAT 1 cut(s) 247
NspI RCATGY 1 cut(s) 132
PaeI GCATGC 1 cut(s) 132
PaeR7I CTCGAG 1 cut(s) 177
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
PspFI CCCAGC 1 cut(s) 289
PspPI GGNCC 1 cut(s) 218
PspXI VCTCGAGB 1 cut(s) 177
SaqAI TTAA 2 cut(s) 269, 285
Sau3AI GATC 3 cut(s) 38, 198, 237
Sau96I GGNCC 1 cut(s) 218
SchI GAGTC 1 cut(s) 77
SduI GDGCHC 1 cut(s) 60
SetI ASST 6 cut(s) 18, 29, 116, 148, 161, 295
SfcI CTRYAG 1 cut(s) 135
Sfr274I CTCGAG 1 cut(s) 177
SlaI CTCGAG 1 cut(s) 177
SmlI CTYRAG 2 cut(s) 160, 177
SmoI CTYRAG 2 cut(s) 160, 177
SphI GCATGC 1 cut(s) 132
Sse9I AATT 2 cut(s) 92, 275
SspMI CTAG 3 cut(s) 24, 281, 294
TaaI ACNGT 1 cut(s) 139
TaqI TCGA 4 cut(s) 11, 110, 142, 178
TasI AATT 2 cut(s) 92, 275
Tru1I TTAA 2 cut(s) 269, 285
Tru9I TTAA 2 cut(s) 269, 285
TscAI CASTG 2 cut(s) 177, 344
TspGWI ACGGA 1 cut(s) 95
TspRI CASTG 2 cut(s) 177, 344
XapI RAATTY 2 cut(s) 92, 275
XceI RCATGY 1 cut(s) 132
XhoI CTCGAG 1 cut(s) 177
XspI CTAG 3 cut(s) 24, 281, 294
Zsp2I ATGCAT 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.