Rh4CG069800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
12972865 .. 12980848
7984 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG069800.1

Sequence Viewer

Length: 195 bp
ATGACAACTCAAGCCCCACCGCCGAACTCCCGATCCAGCTTCTCTCCTTTCAAGTTCCAAGTGTCCAACCCGTCTCGGCGTGCGGCGTCTCCGTCGGTCACTGAGGTTAGTGAGGAGAAGCCCTCAGAAGCAGAGGCCACAATTTCATTGAGGAACGATGAAAATAAAATAAAGAGTTTTGATTTGAAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.05

Weight (kDa)

8.14

Isoelectric Point (pI)

80.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 20, 83
AclWI GGATC 1 cut(s) 27
AcyI GRCGYC 1 cut(s) 86
AgsI TTSAA 2 cut(s) 52, 187
AloI GAACNNNNNNTCC 2 cut(s) 17, 49
AluBI AGCT 1 cut(s) 39
AluI AGCT 1 cut(s) 39
Alw26I GTCTC 2 cut(s) 78, 93
AlwI GGATC 1 cut(s) 27
AoxI GGCC 1 cut(s) 135
BcoDI GTCTC 2 cut(s) 78, 93
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
BplI GAGNNNNNCTC 2 cut(s) 107, 139
BsaHI GRCGYC 1 cut(s) 86
BseMII CTCAG 2 cut(s) 93, 138
BseRI GAGGAG 1 cut(s) 128
BshFI GGCC 1 cut(s) 137
BsmAI GTCTC 2 cut(s) 78, 93
BsmBI CGTCTC 2 cut(s) 78, 93
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 2 cut(s) 20, 83
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 2 cut(s) 94, 137
BspPI GGATC 1 cut(s) 27
BssMI GATC 1 cut(s) 32
BssNI GRCGYC 1 cut(s) 86
BstACI GRCGYC 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 102, 124
BstKTI GATC 1 cut(s) 35
BstMAI GTCTC 2 cut(s) 78, 93
BstMBI GATC 1 cut(s) 32
BsuRI GGCC 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 81
CseI GACGC 1 cut(s) 75
CviJI RGCY 4 cut(s) 14, 39, 121, 137
CviKI_1 RGCY 4 cut(s) 14, 39, 121, 137
DdeI CTNAG 2 cut(s) 102, 124
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
Esp3I CGTCTC 2 cut(s) 78, 93
Fnu4HI GCNGC 1 cut(s) 84
Fsp4HI GCNGC 1 cut(s) 84
GluI GCNGC 1 cut(s) 84
HaeIII GGCC 1 cut(s) 137
HgaI GACGC 1 cut(s) 75
Hin1I GRCGYC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 30
Hpy99I CGWCG 1 cut(s) 97
HpyF3I CTNAG 2 cut(s) 102, 124
Hsp92I GRCGYC 1 cut(s) 86
Kzo9I GATC 1 cut(s) 32
LpnPI CCDG 1 cut(s) 49
MaeIII GTNAC 1 cut(s) 97
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MluCI AATT 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 5 cut(s) 97, 106, 127, 133, 144
NdeII GATC 1 cut(s) 32
NmeAIII GCCGAG 1 cut(s) 55
NmuCI GTSAC 1 cut(s) 97
PkrI GCNGC 1 cut(s) 85
SatI GCNGC 1 cut(s) 84
Sau3AI GATC 1 cut(s) 32
SetI ASST 2 cut(s) 41, 108
SgeI CNNG 8 cut(s) 23, 42, 48, 64, 71, 82, 87, 92
SmlI CTYRAG 1 cut(s) 9
SmoI CTYRAG 1 cut(s) 9
Sse9I AATT 1 cut(s) 141
SsiI CCGC 2 cut(s) 20, 83
TaqII GACCGA 1 cut(s) 85
TasI AATT 1 cut(s) 141
TauI GCSGC 1 cut(s) 86
TscAI CASTG 1 cut(s) 106
TseFI GTSAC 1 cut(s) 97
Tsp45I GTSAC 1 cut(s) 97
TspDTI ATGAA 2 cut(s) 135, 174
TspGWI ACGGA 1 cut(s) 81
TspRI CASTG 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.