Rh4CG442900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
67910116 .. 67910325
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG442900.1

Sequence Viewer

Length: 210 bp
ATGGAAGCGATTTTGAAGAGCAATCCAGACCCGGTTCGTGCTTCTGAGGCCAAGAACAGCTCTGATGGAGATGGTGGTGCAAAGGCCAAGTGTATCAAAAAAGTGGGAGAATGTTTTGGCAGACTTAAAGAAAAAACCATCAAATGGCGTGAACAGGGTCAAGATAGGAGCTCATTTGGGTCTTCCCTGGATCAAAGACAAGTACTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.57

Weight (kDa)

9.34

Isoelectric Point (pI)

36.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 144
AclWI GGATC 1 cut(s) 198
AfaI GTAC 1 cut(s) 204
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 1 cut(s) 16
AjnI CCWGG 1 cut(s) 186
AluBI AGCT 2 cut(s) 60, 171
AluI AGCT 2 cut(s) 60, 171
Alw21I GWGCWC 1 cut(s) 173
AlwI GGATC 1 cut(s) 198
AoxI GGCC 2 cut(s) 48, 84
AsuC2I CCSGG 1 cut(s) 32
BanII GRGCYC 1 cut(s) 173
BbsI GAAGAC 1 cut(s) 174
Bbv12I GWGCWC 1 cut(s) 173
BccI CCATC 3 cut(s) 59, 65, 146
BciT130I CCWGG 1 cut(s) 188
BcnI CCSGG 1 cut(s) 32
BmcAI AGTACT 1 cut(s) 204
Bme1390I CCNGG 2 cut(s) 32, 188
BmrFI CCNGG 2 cut(s) 32, 188
BpiI GAAGAC 1 cut(s) 174
BpuMI CCSGG 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 144
BseBI CCWGG 1 cut(s) 188
BseDI CCNNGG 1 cut(s) 186
BseLI CCNNNNNNNGG 1 cut(s) 144
BseMII CTCAG 1 cut(s) 36
BshFI GGCC 2 cut(s) 50, 86
BsiHKAI GWGCWC 1 cut(s) 173
BsiSI CCGG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 144
BsnI GGCC 2 cut(s) 50, 86
Bsp1286I GDGCHC 1 cut(s) 173
Bsp143I GATC 1 cut(s) 190
BspANI GGCC 2 cut(s) 50, 86
BspCNI CTCAG 1 cut(s) 37
BspPI GGATC 1 cut(s) 198
BspQI GCTCTTC 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 186
BssMI GATC 1 cut(s) 190
Bst2UI CCWGG 1 cut(s) 188
Bst6I CTCTTC 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 45
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstNI CCWGG 1 cut(s) 188
BstSCI CCNGG 2 cut(s) 30, 186
BstV2I GAAGAC 1 cut(s) 174
BsuRI GGCC 2 cut(s) 50, 86
Csp6I GTAC 1 cut(s) 203
CviJI RGCY 4 cut(s) 50, 60, 86, 171
CviKI_1 RGCY 4 cut(s) 50, 60, 86, 171
CviQI GTAC 1 cut(s) 203
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eam1104I CTCTTC 1 cut(s) 11
EarI CTCTTC 1 cut(s) 11
Ecl136II GAGCTC 1 cut(s) 171
Eco24I GRGCYC 1 cut(s) 173
Eco53kI GAGCTC 1 cut(s) 171
EcoICRI GAGCTC 1 cut(s) 171
EcoRII CCWGG 1 cut(s) 186
EcoT38I GRGCYC 1 cut(s) 173
FaiI YATR 1 cut(s) 208
FriOI GRGCYC 1 cut(s) 173
HaeIII GGCC 2 cut(s) 50, 86
HapII CCGG 1 cut(s) 32
HpaII CCGG 1 cut(s) 32
Hpy166II GTNNAC 1 cut(s) 152
Hpy188I TCNGA 2 cut(s) 46, 64
Hpy188III TCNNGA 2 cut(s) 26, 161
Hpy8I GTNNAC 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 45
Kzo9I GATC 1 cut(s) 190
LguI GCTCTTC 1 cut(s) 11
LmnI GCTCC 1 cut(s) 168
LpnPI CCDG 5 cut(s) 39, 45, 140, 173, 200
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 2 cut(s) 28, 174
MhlI GDGCHC 1 cut(s) 173
MnlI CCTC 1 cut(s) 40
MseI TTAA 1 cut(s) 126
MspI CCGG 1 cut(s) 32
MspR9I CCNGG 2 cut(s) 32, 188
MvaI CCWGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 47
NciI CCSGG 1 cut(s) 32
NdeII GATC 1 cut(s) 190
PciSI GCTCTTC 1 cut(s) 11
PflMI CCANNNNNTGG 1 cut(s) 144
Psp124BI GAGCTC 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 186
PspGI CCWGG 1 cut(s) 186
RsaI GTAC 1 cut(s) 204
RsaNI GTAC 1 cut(s) 203
SacI GAGCTC 1 cut(s) 173
SapI GCTCTTC 1 cut(s) 11
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 190
ScaI AGTACT 1 cut(s) 204
ScrFI CCNGG 2 cut(s) 32, 188
SduI GDGCHC 1 cut(s) 173
SetI ASST 2 cut(s) 62, 173
SstI GAGCTC 1 cut(s) 173
StyD4I CCNGG 2 cut(s) 30, 186
TatI WGTACW 1 cut(s) 202
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
Van91I CCANNNNNTGG 1 cut(s) 144
ZrmI AGTACT 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.