Rh5BG300100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
38708523 .. 38711807
3285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG300100.1

Sequence Viewer

Length: 291 bp
ATGATAGCAACTCAGACAGATAATATTGCTAGACTACGAGCACAGGTGTTGGAATTGGAGCAATCCAGGAATAATCTTATACAAGAAAACCAAAAGCCGATGGGAAATTTATCTGGTCCAGAGTTGCAAATTAAGGACCTTGAGAGTGTTTCTTCTAATCGCTCATTAGTTGAAGGTGCAAAGTGCCAATTCGAAGTTCAGGGAGAGACTGCAGGAAGTGCTGAAATGGTGCTCAATGAAGATGATTGTAAGAATACTGAACTCAGAAACTATGAAAGAATGTCGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.77

Weight (kDa)

4.59

Isoelectric Point (pI)

43.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 106
AgsI TTSAA 1 cut(s) 173
AjnI CCWGG 1 cut(s) 65
AjuI GAANNNNNNNTTGG 2 cut(s) 180, 212
Alw21I GWGCWC 2 cut(s) 43, 234
Alw26I GTCTC 1 cut(s) 200
ApoI RAATTY 1 cut(s) 106
AspS9I GGNCC 2 cut(s) 116, 136
AsuII TTCGAA 1 cut(s) 192
AvaII GGWCC 2 cut(s) 116, 136
Bbv12I GWGCWC 2 cut(s) 43, 234
BccI CCATC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 67
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 210
Bme1390I CCNGG 1 cut(s) 67
Bme18I GGWCC 2 cut(s) 116, 136
BmgT120I GGNCC 2 cut(s) 116, 136
BmrFI CCNGG 1 cut(s) 67
Bpu14I TTCGAA 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 161
BseBI CCWGG 1 cut(s) 67
BseMII CTCAG 2 cut(s) 26, 277
BsiHKAI GWGCWC 2 cut(s) 43, 234
BsmAI GTCTC 1 cut(s) 200
Bsp119I TTCGAA 1 cut(s) 192
Bsp1286I GDGCHC 2 cut(s) 43, 234
BspCNI CTCAG 2 cut(s) 25, 276
BspMAI CTGCAG 1 cut(s) 214
BspT104I TTCGAA 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 67
BstAPI GCANNNNNTGC 1 cut(s) 218
BstBI TTCGAA 1 cut(s) 192
BstDEI CTNAG 2 cut(s) 12, 263
BstMAI GTCTC 1 cut(s) 200
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstNI CCWGG 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 65
BstSFI CTRYAG 1 cut(s) 210
Cfr13I GGNCC 2 cut(s) 116, 136
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
DdeI CTNAG 2 cut(s) 12, 263
Eco47I GGWCC 2 cut(s) 116, 136
EcoO109I RGGNCCY 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 65
FaiI YATR 2 cut(s) 80, 273
FspBI CTAG 1 cut(s) 30
Hpy188I TCNGA 2 cut(s) 15, 266
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 167
HpyCH4V TGCA 3 cut(s) 127, 179, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
HpyF3I CTNAG 2 cut(s) 12, 263
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 7 cut(s) 29, 52, 79, 99, 132, 185, 198
MaeI CTAG 1 cut(s) 30
MboII GAAGA 2 cut(s) 144, 251
MhlI GDGCHC 2 cut(s) 43, 234
MluCI AATT 4 cut(s) 53, 106, 129, 188
MmeI TCCRAC 1 cut(s) 30
MseI TTAA 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 67
MvaI CCWGG 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 218
NspV TTCGAA 1 cut(s) 192
PfoI TCCNGGA 1 cut(s) 65
PpuMI RGGWCCY 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 65
PspGI CCWGG 1 cut(s) 65
PspPI GGNCC 2 cut(s) 116, 136
PspPPI RGGWCCY 1 cut(s) 136
PstI CTGCAG 1 cut(s) 214
SaqAI TTAA 1 cut(s) 132
Sau96I GGNCC 2 cut(s) 116, 136
ScrFI CCNGG 1 cut(s) 67
SduI GDGCHC 2 cut(s) 43, 234
SetI ASST 3 cut(s) 48, 141, 178
SfcI CTRYAG 1 cut(s) 210
SfuI TTCGAA 1 cut(s) 192
SinI GGWCC 2 cut(s) 116, 136
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 4 cut(s) 53, 106, 129, 188
SspI AATATT 1 cut(s) 25
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 65
TaqI TCGA 1 cut(s) 192
TasI AATT 4 cut(s) 53, 106, 129, 188
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 2 cut(s) 252, 288
VpaK11BI GGWCC 2 cut(s) 116, 136
XapI RAATTY 1 cut(s) 106
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.