Rh7DG221400

Ribosomal RNA-processing protein 7 (RRP7)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
21528107 .. 21529398
1292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG221400.1

Sequence Viewer

Length: 204 bp
ATGAGCCAAAGACACACAACACCTGCGAAATTAGTCAAGTTCAGTCAAGTTCCGAACTTGGTCTCATATTTTGACGATGAAGCCGCAGATGATCAGAGCAAATTCGAAGTTCAGGGAGAGACTACAGGAAGTGCTGAAATGGTGCTCAATGAAGATGATTGTAAGAATACTGAACTCAGAAACTATGAAAGAATGTCGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.65

Weight (kDa)

4.49

Isoelectric Point (pI)

46.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 31
Acc36I ACCTGC 1 cut(s) 31
AciI CCGC 1 cut(s) 84
AcsI RAATTY 1 cut(s) 101
Alw21I GWGCWC 1 cut(s) 147
Alw26I GTCTC 2 cut(s) 67, 113
ApoI RAATTY 1 cut(s) 101
AsuII TTCGAA 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 147
BclI TGATCA 1 cut(s) 91
BcoDI GTCTC 2 cut(s) 67, 113
BfmI CTRYAG 1 cut(s) 123
BfuAI ACCTGC 1 cut(s) 31
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
Bpu14I TTCGAA 1 cut(s) 105
BsaI GGTCTC 1 cut(s) 67
BseMII CTCAG 1 cut(s) 190
BsiHKAI GWGCWC 1 cut(s) 147
BsmAI GTCTC 2 cut(s) 67, 113
Bso31I GGTCTC 1 cut(s) 67
Bsp119I TTCGAA 1 cut(s) 105
Bsp1286I GDGCHC 1 cut(s) 147
Bsp143I GATC 1 cut(s) 91
BspACI CCGC 1 cut(s) 84
BspCNI CTCAG 1 cut(s) 189
BspMI ACCTGC 1 cut(s) 31
BspT104I TTCGAA 1 cut(s) 105
BspTNI GGTCTC 1 cut(s) 67
BssMI GATC 1 cut(s) 91
BstBI TTCGAA 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 176
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 2 cut(s) 67, 113
BstMBI GATC 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 123
BveI ACCTGC 1 cut(s) 31
CviJI RGCY 2 cut(s) 6, 83
CviKI_1 RGCY 2 cut(s) 6, 83
DdeI CTNAG 1 cut(s) 176
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco31I GGTCTC 1 cut(s) 67
FaiI YATR 2 cut(s) 67, 186
FbaI TGATCA 1 cut(s) 91
Fnu4HI GCNGC 1 cut(s) 84
Fsp4HI GCNGC 1 cut(s) 84
FspEI CC 9 cut(s) 20, 36, 44, 66, 97, 98, 99, 111, 125
GluI GCNGC 1 cut(s) 84
Hpy188I TCNGA 3 cut(s) 54, 96, 179
HpyF3I CTNAG 1 cut(s) 176
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 3 cut(s) 36, 98, 111
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 1 cut(s) 164
MhlI GDGCHC 1 cut(s) 147
MluCI AATT 2 cut(s) 29, 101
NdeII GATC 1 cut(s) 91
NspV TTCGAA 1 cut(s) 105
PaqCI CACCTGC 1 cut(s) 31
PkrI GCNGC 1 cut(s) 85
SatI GCNGC 1 cut(s) 84
Sau3AI GATC 1 cut(s) 91
SduI GDGCHC 1 cut(s) 147
SetI ASST 1 cut(s) 25
SfcI CTRYAG 1 cut(s) 123
SfuI TTCGAA 1 cut(s) 105
SgeI CNNG 6 cut(s) 35, 49, 59, 70, 125, 138
Sse9I AATT 2 cut(s) 29, 101
SsiI CCGC 1 cut(s) 84
TaqI TCGA 1 cut(s) 105
TasI AATT 2 cut(s) 29, 101
TauI GCSGC 1 cut(s) 86
TspDTI ATGAA 3 cut(s) 93, 165, 201
XapI RAATTY 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.