Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6B

Orthogroup ID

OG0005665

Physical Location & Seq

Genomic Coordinates Reverse (-)

50298910 .. 50306109

Gene Structure 7200 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6BG281200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

ATGGTAAAGTATCTAGAGGTTAAAGATGGAATTTTCAGGCCCTTGAAATTCAGAGGCCTAGGCGGTCGCCTCATGTCCAATTCTCATGATCGACCCTACTATAATACGCTCATCAACAAAATGCTAGGTGAAAGCAAAAGCAGTAAAGAAGCAGAGAAGTCATCGATCATTGGGTTCATACCACATAGGATATGGCTGTCAAATGATCAGGAACATGAAAAGATATATCCGATAATTGGGGATAGATACCGGTGCAAAGATTGTGTGGAGAAAATTGGCTTTGATCTTTGCAATGATTGTTATAATACTGGTTCCAAGCTTCCAGGTCGATTTAATCAGCAACATACAGCAGAACACCAGTTTGAGCTTATACGCAGCGACATTATTCGTGGGTCAGTTAAGGATAATGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

137

Amino Acids

15.93

Weight (kDa)

8.66

Isoelectric Point (pI)

22.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005665)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G24800
fragaria_vesca	FvH4_2g19100 FvH4_2g19100 FvH4_2g19100 FvH4_6g51520
malus_domestica	MD10G1165000.v1.1
prunus_persica	Prupe.8G203400_v2.0.a1 Prupe.8G203400_v2.0.a1 Prupe.8G203400_v2.0.a1
pyrus_communis	pycom10g14220
rosa_chinensis	RchiOBHm_Chr6g0284931
rosa_laevigata	RLG00000012700 RLG00000012701
rosa_multiflora	Rmu_sc0004961.1_g000001 Rmu_sc0004961.1_g000002
rosa_roxburghii	Rroxscaffold_7G00183950 Rroxscaffold_7G00183960 Rroxscaffold_7G00184220
rosa_rugosa	Rorug06G0168600 Rorug06G0168700
rosa_samantha	Rh6AG280700 Rh6BG281000 Rh6BG281100 Rh6BG281200 Rh6BG281300 Rh6CG283000 Rh6DG276100
rosa_wichuraiana	Rw6G024120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	303
AciI	CCGC	1 cut(s)	63
AcsI	RAATTY	2 cut(s)	30, 47
AfiI	CCNNNNNNNGG	1 cut(s)	236
AgeI	ACCGGT	1 cut(s)	249
AgsI	TTSAA	1 cut(s)	46
AjnI	CCWGG	1 cut(s)	322
AluBI	AGCT	2 cut(s)	319, 367
AluI	AGCT	2 cut(s)	319, 367
AoxI	GGCC	2 cut(s)	38, 55
ApeKI	GCWGC	1 cut(s)	375
ApoI	RAATTY	2 cut(s)	30, 47
AsiGI	ACCGGT	1 cut(s)	249
AspA2I	CCTAGG	1 cut(s)	58
AspS9I	GGNCC	1 cut(s)	39
AsuHPI	GGTGA	1 cut(s)	140
AvrII	CCTAGG	1 cut(s)	58
BbvI	GCAGC	1 cut(s)	387
BccI	CCATC	1 cut(s)	20
BciT130I	CCWGG	1 cut(s)	324
BclI	TGATCA	1 cut(s)	205
BfaI	CTAG	3 cut(s)	14, 59, 125
BisI	GCNGC	1 cut(s)	376
BlnI	CCTAGG	1 cut(s)	58
BlsI	GCNGC	1 cut(s)	377
Bme1390I	CCNGG	1 cut(s)	324
BmgT120I	GGNCC	1 cut(s)	39
BmiI	GGNNCC	1 cut(s)	313
BmrFI	CCNGG	1 cut(s)	324
Bsa29I	ATCGAT	1 cut(s)	164
BsaJI	CCNNGG	1 cut(s)	58
BsaWI	WCCGGW	1 cut(s)	249
Bsc4I	CCNNNNNNNGG	1 cut(s)	236
Bse118I	RCCGGY	1 cut(s)	249
Bse1I	ACTGG	2 cut(s)	313, 358
Bse3DI	GCAATG	1 cut(s)	298
BseBI	CCWGG	1 cut(s)	324
BseCI	ATCGAT	1 cut(s)	164
BseDI	CCNNGG	1 cut(s)	58
BseLI	CCNNNNNNNGG	1 cut(s)	236
BseMI	GCAATG	1 cut(s)	298
BseNI	ACTGG	2 cut(s)	313, 358
BseXI	GCAGC	1 cut(s)	387
Bsh1285I	CGRYCG	1 cut(s)	67
BshFI	GGCC	2 cut(s)	40, 57
BshTI	ACCGGT	1 cut(s)	249
BshVI	ATCGAT	1 cut(s)	164
BsiEI	CGRYCG	1 cut(s)	67
BsiSI	CCGG	1 cut(s)	250
BslI	CCNNNNNNNGG	1 cut(s)	236
BsnI	GGCC	2 cut(s)	40, 57
Bsp143I	GATC	4 cut(s)	88, 165, 205, 283
BspACI	CCGC	1 cut(s)	63
BspANI	GGCC	2 cut(s)	40, 57
BspDI	ATCGAT	1 cut(s)	164
BspHI	TCATGA	1 cut(s)	85
BspLI	GGNNCC	1 cut(s)	313
BsrDI	GCAATG	1 cut(s)	298
BsrFI	RCCGGY	1 cut(s)	249
BsrI	ACTGG	2 cut(s)	313, 358
BssAI	RCCGGY	1 cut(s)	249
BssECI	CCNNGG	1 cut(s)	58
BssMI	GATC	4 cut(s)	88, 165, 205, 283
BssT1I	CCWWGG	1 cut(s)	58
Bst2UI	CCWGG	1 cut(s)	324
BstKTI	GATC	4 cut(s)	91, 168, 208, 286
BstMBI	GATC	4 cut(s)	88, 165, 205, 283
BstMCI	CGRYCG	1 cut(s)	67
BstNI	CCWGG	1 cut(s)	324
BstSCI	CCNGG	1 cut(s)	322
BstV1I	GCAGC	1 cut(s)	387
Bsu15I	ATCGAT	1 cut(s)	164
BsuRI	GGCC	2 cut(s)	40, 57
BsuTUI	ATCGAT	1 cut(s)	164
CciI	TCATGA	1 cut(s)	85
Cfr10I	RCCGGY	1 cut(s)	249
Cfr13I	GGNCC	1 cut(s)	39
ClaI	ATCGAT	1 cut(s)	164
CspAI	ACCGGT	1 cut(s)	249
CviAII	CATG	3 cut(s)	73, 86, 215
CviJI	RGCY	6 cut(s)	40, 57, 196, 279, 319, 367
CviKI_1	RGCY	6 cut(s)	40, 57, 196, 279, 319, 367
DpnI	GATC	4 cut(s)	90, 167, 207, 285
DpnII	GATC	4 cut(s)	88, 165, 205, 283
Eco130I	CCWWGG	1 cut(s)	58
Eco147I	AGGCCT	1 cut(s)	57
EcoO109I	RGGNCCY	1 cut(s)	39
EcoRII	CCWGG	1 cut(s)	322
EcoT14I	CCWWGG	1 cut(s)	58
ErhI	CCWWGG	1 cut(s)	58
FaeI	CATG	3 cut(s)	76, 89, 218
FatI	CATG	3 cut(s)	72, 85, 214
FbaI	TGATCA	1 cut(s)	205
Fnu4HI	GCNGC	1 cut(s)	376
Fsp4HI	GCNGC	1 cut(s)	376
FspBI	CTAG	3 cut(s)	14, 59, 125
GluI	GCNGC	1 cut(s)	376
HaeIII	GGCC	2 cut(s)	40, 57
HapII	CCGG	1 cut(s)	250
Hin1II	CATG	3 cut(s)	76, 89, 218
HindIII	AAGCTT	1 cut(s)	317
HpaII	CCGG	1 cut(s)	250
HphI	GGTGA	1 cut(s)	140
Hpy188I	TCNGA	2 cut(s)	53, 231
Hpy188III	TCNNGA	3 cut(s)	14, 86, 209
HpyCH4V	TGCA	2 cut(s)	255, 291
Hsp92II	CATG	3 cut(s)	76, 89, 218
Ksp22I	TGATCA	1 cut(s)	205
Kzo9I	GATC	4 cut(s)	88, 165, 205, 283
LpnPI	CCDG	7 cut(s)	22, 194, 263, 294, 309, 336, 371
Lsp1109I	GCAGC	1 cut(s)	387
MaeI	CTAG	3 cut(s)	14, 59, 125
MalI	GATC	4 cut(s)	90, 167, 207, 285
MboI	GATC	4 cut(s)	88, 165, 205, 283
MluCI	AATT	5 cut(s)	30, 47, 79, 234, 273
MnlI	CCTC	3 cut(s)	10, 47, 80
MseI	TTAA	3 cut(s)	21, 333, 399
MspI	CCGG	1 cut(s)	250
MspR9I	CCNGG	1 cut(s)	324
MvaI	CCWGG	1 cut(s)	324
NdeII	GATC	4 cut(s)	88, 165, 205, 283
NlaIII	CATG	3 cut(s)	76, 89, 218
NlaIV	GGNNCC	1 cut(s)	313
PagI	TCATGA	1 cut(s)	85
PceI	AGGCCT	1 cut(s)	57
PinAI	ACCGGT	1 cut(s)	249
PkrI	GCNGC	1 cut(s)	377
PsiI	TTATAA	1 cut(s)	303
Psp6I	CCWGG	1 cut(s)	322
PspGI	CCWGG	1 cut(s)	322
PspN4I	GGNNCC	1 cut(s)	313
PspPI	GGNCC	1 cut(s)	39
SaqAI	TTAA	3 cut(s)	21, 333, 399
SatI	GCNGC	1 cut(s)	376
Sau3AI	GATC	4 cut(s)	88, 165, 205, 283
Sau96I	GGNCC	1 cut(s)	39
ScrFI	CCNGG	1 cut(s)	324
SetI	ASST	5 cut(s)	21, 130, 321, 328, 369
Sse9I	AATT	5 cut(s)	30, 47, 79, 234, 273
SseBI	AGGCCT	1 cut(s)	57
SsiI	CCGC	1 cut(s)	63
SspMI	CTAG	3 cut(s)	14, 59, 125
StuI	AGGCCT	1 cut(s)	57
StyD4I	CCNGG	1 cut(s)	322
StyI	CCWWGG	1 cut(s)	58
TaqI	TCGA	3 cut(s)	91, 164, 328
TasI	AATT	5 cut(s)	30, 47, 79, 234, 273
Tru1I	TTAA	3 cut(s)	21, 333, 399
Tru9I	TTAA	3 cut(s)	21, 333, 399
TseI	GCWGC	1 cut(s)	375
TspDTI	ATGAA	2 cut(s)	166, 231
XapI	RAATTY	2 cut(s)	30, 47
XbaI	TCTAGA	1 cut(s)	13
XcmI	CCANNNNNNNNNTGG	1 cut(s)	189
XmaJI	CCTAGG	1 cut(s)	58
XspI	CTAG	3 cut(s)	14, 59, 125

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.