Rh6CG042100

F-box FBD LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0007537
Physical Location & Seq
Reverse (-)
4123279 .. 4123593
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG042100.1

Sequence Viewer

Length: 315 bp
ATGGATCGGAGAGAGAAACTCGAAAGGAGACACTCTGTTGTCGAAGAAGTGAAGTCTTCTTGTTTAAATGACAACTACAATTGCACATTTTCTCAACTGCGACTTGTGAAAATAACTGAGATCTCTGGTGTTAAAGCTGAACTAGATTTCATCAGATTTCTACTTTTAAGTTCCCCTCTGCTTGAGAGAATGACTATCACGCCTCCTCGATTTCCTAAGCCTGCTTCTGTGGATGGTTTTCCGAAACTAGTAAAAGAGCTACTCCAGTTTAAACGTGAATCAAAGCATGCAGAGATTATTCTCCTGGACCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

104

Amino Acids

12.1

Weight (kDa)

9.03

Isoelectric Point (pI)

59.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 28 - 66 1.3e-06 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AhlI ACTAGT 1 cut(s) 247
AjnI CCWGG 1 cut(s) 303
AluBI AGCT 2 cut(s) 137, 259
AluI AGCT 2 cut(s) 137, 259
Alw26I GTCTC 1 cut(s) 22
AlwI GGATC 1 cut(s) 12
AspS9I GGNCC 1 cut(s) 307
AvaII GGWCC 1 cut(s) 307
BbsI GAAGAC 1 cut(s) 48
BccI CCATC 1 cut(s) 227
BciT130I CCWGG 1 cut(s) 305
BcoDI GTCTC 1 cut(s) 22
BcuI ACTAGT 1 cut(s) 247
BfaI CTAG 2 cut(s) 143, 248
BglII AGATCT 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 305
Bme18I GGWCC 1 cut(s) 307
BmgT120I GGNCC 1 cut(s) 307
BmiI GGNNCC 1 cut(s) 309
BmrFI CCNGG 1 cut(s) 305
BpiI GAAGAC 1 cut(s) 48
BplI GAGNNNNNCTC 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 248
Bpu10I CCTNAGC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 203
Bse1I ACTGG 1 cut(s) 265
BseBI CCWGG 1 cut(s) 305
BseGI GGATG 1 cut(s) 238
BseMII CTCAG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 265
BseRI GAGGAG 1 cut(s) 195
BsmAI GTCTC 1 cut(s) 22
Bsp143I GATC 2 cut(s) 4, 120
BspCNI CTCAG 1 cut(s) 109
BspLI GGNNCC 1 cut(s) 309
BspPI GGATC 1 cut(s) 12
BsrI ACTGG 1 cut(s) 265
BssMI GATC 2 cut(s) 4, 120
Bst2UI CCWGG 1 cut(s) 305
BstC8I GCNNGC 2 cut(s) 222, 288
BstDEI CTNAG 2 cut(s) 117, 216
BstF5I GGATG 1 cut(s) 238
BstKTI GATC 2 cut(s) 7, 123
BstMAI GTCTC 1 cut(s) 22
BstMBI GATC 2 cut(s) 4, 120
BstNI CCWGG 1 cut(s) 305
BstNSI RCATGY 1 cut(s) 290
BstSCI CCNGG 1 cut(s) 303
BstV2I GAAGAC 1 cut(s) 48
BstX2I RGATCY 1 cut(s) 120
BstYI RGATCY 1 cut(s) 120
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 2 cut(s) 222, 288
Cfr13I GGNCC 1 cut(s) 307
CviAII CATG 1 cut(s) 287
CviJI RGCY 3 cut(s) 137, 220, 259
CviKI_1 RGCY 3 cut(s) 137, 220, 259
DdeI CTNAG 2 cut(s) 117, 216
DpnI GATC 2 cut(s) 6, 122
DpnII GATC 2 cut(s) 4, 120
DraI TTTAAA 2 cut(s) 66, 271
Eco47I GGWCC 1 cut(s) 307
EcoRII CCWGG 1 cut(s) 303
FaeI CATG 1 cut(s) 290
FaiI YATR 2 cut(s) 288, 313
FatI CATG 1 cut(s) 286
FokI GGATG 1 cut(s) 245
FspBI CTAG 2 cut(s) 143, 248
GsuI CTGGAG 1 cut(s) 248
Hin1II CATG 1 cut(s) 290
HinfI GANTC 1 cut(s) 278
Hpy188I TCNGA 3 cut(s) 9, 155, 243
HpyCH4IV ACGT 1 cut(s) 274
HpyCH4V TGCA 2 cut(s) 84, 290
HpyF3I CTNAG 2 cut(s) 117, 216
HpySE526I ACGT 1 cut(s) 274
Hsp92II CATG 1 cut(s) 290
Kzo9I GATC 2 cut(s) 4, 120
LpnPI CCDG 4 cut(s) 111, 234, 278, 290
MaeI CTAG 2 cut(s) 143, 248
MaeII ACGT 1 cut(s) 274
MalI GATC 2 cut(s) 6, 122
MboI GATC 2 cut(s) 4, 120
MboII GAAGA 2 cut(s) 48, 56
MfeI CAATTG 1 cut(s) 79
MflI RGATCY 1 cut(s) 120
MluCI AATT 1 cut(s) 79
MnlI CCTC 3 cut(s) 186, 213, 216
MseI TTAA 4 cut(s) 65, 132, 167, 270
MspR9I CCNGG 1 cut(s) 305
MssI GTTTAAAC 1 cut(s) 271
MunI CAATTG 1 cut(s) 79
MvaI CCWGG 1 cut(s) 305
NdeII GATC 2 cut(s) 4, 120
NlaIII CATG 1 cut(s) 290
NlaIV GGNNCC 1 cut(s) 309
NspI RCATGY 1 cut(s) 290
PaeI GCATGC 1 cut(s) 290
PfeI GAWTC 1 cut(s) 278
PfoI TCCNGGA 1 cut(s) 303
PmeI GTTTAAAC 1 cut(s) 271
Psp6I CCWGG 1 cut(s) 303
PspGI CCWGG 1 cut(s) 303
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 1 cut(s) 307
PsuI RGATCY 1 cut(s) 120
SaqAI TTAA 4 cut(s) 65, 132, 167, 270
Sau3AI GATC 2 cut(s) 4, 120
Sau96I GGNCC 1 cut(s) 307
ScrFI CCNGG 1 cut(s) 305
SetI ASST 3 cut(s) 139, 261, 277
SinI GGWCC 1 cut(s) 307
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
SpeI ACTAGT 1 cut(s) 247
SphI GCATGC 1 cut(s) 290
Sse9I AATT 1 cut(s) 79
SspMI CTAG 2 cut(s) 143, 248
StyD4I CCNGG 1 cut(s) 303
TaiI ACGT 1 cut(s) 277
TaqI TCGA 3 cut(s) 21, 42, 208
TasI AATT 1 cut(s) 79
TfiI GAWTC 1 cut(s) 278
Tru1I TTAA 4 cut(s) 65, 132, 167, 270
Tru9I TTAA 4 cut(s) 65, 132, 167, 270
TspDTI ATGAA 1 cut(s) 139
VpaK11BI GGWCC 1 cut(s) 307
XceI RCATGY 1 cut(s) 290
XspI CTAG 2 cut(s) 143, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.