Rh6DG038000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
4095312 .. 4095558
247 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG038000.1

Sequence Viewer

Length: 150 bp
ATGTCAATTCTTGATCAAGAAAAAGGCAAAGCACCATACAAGATTACAAACACGAGAGAAGAAGAACAGTCGAAGGTAGATTTTGCGACAGAGCTAGATCTGGACGAAGCTCCAGGTCGCTGCTTAGTGATCGAGTTAAGAGTGTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.58

Weight (kDa)

4.58

Isoelectric Point (pI)

65.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 112
AluBI AGCT 2 cut(s) 94, 110
AluI AGCT 2 cut(s) 94, 110
ApeKI GCWGC 1 cut(s) 120
BauI CACGAG 1 cut(s) 52
BbvI GCAGC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 114
BclI TGATCA 1 cut(s) 13
BfaI CTAG 1 cut(s) 95
BglII AGATCT 1 cut(s) 97
BisI GCNGC 1 cut(s) 121
BlsI GCNGC 1 cut(s) 122
Bme1390I CCNGG 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 114
BpmI CTGGAG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 114
BseXI GCAGC 1 cut(s) 107
Bsp143I GATC 3 cut(s) 13, 97, 129
BssMI GATC 3 cut(s) 13, 97, 129
BssSI CACGAG 1 cut(s) 52
Bst2BI CACGAG 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 124
BstKTI GATC 3 cut(s) 16, 100, 132
BstMBI GATC 3 cut(s) 13, 97, 129
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BstV1I GCAGC 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
CviJI RGCY 2 cut(s) 94, 110
CviKI_1 RGCY 2 cut(s) 94, 110
DdeI CTNAG 1 cut(s) 124
DpnI GATC 3 cut(s) 15, 99, 131
DpnII GATC 3 cut(s) 13, 97, 129
EcoRII CCWGG 1 cut(s) 112
FaiI YATR 1 cut(s) 37
FbaI TGATCA 1 cut(s) 13
Fnu4HI GCNGC 1 cut(s) 121
Fsp4HI GCNGC 1 cut(s) 121
FspBI CTAG 1 cut(s) 95
FspEI CC 6 cut(s) 9, 48, 59, 86, 99, 126
GluI GCNGC 1 cut(s) 121
GsuI CTGGAG 1 cut(s) 96
Hpy188III TCNNGA 3 cut(s) 11, 17, 101
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 1 cut(s) 69
HpyF3I CTNAG 1 cut(s) 124
Ksp22I TGATCA 1 cut(s) 13
Kzo9I GATC 3 cut(s) 13, 97, 129
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 3 cut(s) 86, 99, 126
Lsp1109I GCAGC 1 cut(s) 107
MaeI CTAG 1 cut(s) 95
MalI GATC 3 cut(s) 15, 99, 131
MboI GATC 3 cut(s) 13, 97, 129
MboII GAAGA 2 cut(s) 71, 74
MflI RGATCY 1 cut(s) 97
MluCI AATT 1 cut(s) 6
MseI TTAA 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeII GATC 3 cut(s) 13, 97, 129
PkrI GCNGC 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PsuI RGATCY 1 cut(s) 97
SaqAI TTAA 1 cut(s) 137
SatI GCNGC 1 cut(s) 121
Sau3AI GATC 3 cut(s) 13, 97, 129
ScrFI CCNGG 1 cut(s) 114
SetI ASST 4 cut(s) 78, 96, 112, 118
Sse9I AATT 1 cut(s) 6
SspMI CTAG 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 112
TaaI ACNGT 1 cut(s) 69
TaqI TCGA 2 cut(s) 71, 132
TasI AATT 1 cut(s) 6
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TseI GCWGC 1 cut(s) 120
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.